1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yan [13]
3 years ago
14

PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one

of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP

Biology
2 answers:
Yuliya22 [10]3 years ago
8 0

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Tom [10]3 years ago
6 0

Answer:

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Explanation:

Hope This Helps!

Please Mark Me Brainly!

You might be interested in
for the freckles trait, having freckles (F) is dominant while no freckles (f) is recessive. What will someone that is Ff look li
valina [46]
They'll have freckles because the dominant trait always overpowers the recessive trait if it's present.
5 0
3 years ago
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

  • Start codon ⇒ ATG
  • Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0
3 years ago
What are the two basic body forms
balu736 [363]

Answer:

body forms of what?

Explanation:

be more specific

5 0
3 years ago
PLEASE HELP!!! 50 POINTS!
Lelu [443]

Answer:

The answer is C

Explanation:

Soil is rock but broken down into tiny rock.

Hope this helps    :)

6 0
3 years ago
Read 2 more answers
Why does the mid-day winter sun not produce as much intense heat as the mid-day summer sun?
makkiz [27]
F. b and c only the Sun is closer to the horizon <span> the Sun’s light is spread and diluted more</span>
8 0
3 years ago
Other questions:
  • The levels of organization for structure and function in the human body from least complex to most complex are
    9·1 answer
  • When you leave for school it is sunny outside.when you come home from school it is cloudy and raining
    8·2 answers
  • Neurons are highly specialized cells that have lost the ability to divide.what phase are neurons in?
    5·2 answers
  • How can budding produce a new organisms
    6·1 answer
  • How does carbon dioxide enter the atmosphere?
    6·2 answers
  • How does air pollution from combustion engines, industrial processing, and fossil fuels affect the biosphere?
    7·1 answer
  • A scientist that studies the climate and weather patterns of the area
    9·2 answers
  • Describe three features of a tropical rainforest​
    14·1 answer
  • What is the cdc and what dose it have to do with healthy weight levels
    8·1 answer
  • A person's blood type is determined by?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!