1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulijaS [17]
3 years ago
12

Why might a person who has skin cancer later develop a tumour on her lungs?

Biology
2 answers:
kondaur [170]3 years ago
5 0
Results showed that people with nonmelanoma skin cancer were at an increased risk of developing the deadly skin cancer melanoma, and that women with nonmelanoma skin cancer were at increased risk of lung cancer and breast cancer, according to the study. Common sites for metastases include the lymph nodes, lungs, liver, bones and brain. Melanoma tumors that have metastasized to other parts of the body are still considered melanoma. For example, melanoma found in the lungs is called metastatic melanoma of the lung or melanoma with lung metastases. Skin cancer is the out-of-control growth of abnormal cells in the epidermis, the outermost skin layer, caused by unrepaired DNA damage that triggers mutations. These mutations lead the skin cells to multiply rapidly and form malignant tumors. Hope this helps!
alina1380 [7]3 years ago
3 0

Answer:  The cancer of the skin metastasizes into the lymph joints (spreads), and they run everywhere in the body, dropping bad cells when they go. the lungs are super vascular (carry a lot of blood flow), and so is the organ. Therefore, they are favorite places for the cancer cells to end up and grow.

Explanation:  hoped this helped:)) you can just search it up

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Why is personal hygiene important for limiting the spread of diseases?
Artemon [7]

Answer:

It limits the spread of pathogens

Explanation:

Many diseases are contracted byu direct contact with an individual that is a carrier of a disease. The pathogens primarily spread by direct contact includes parasites, certain bacteria, certain viruses. For example, viruses include: Hepatitis A and Hepatitis E and are associated with poor sanitation and hygiene, leading to infection and inflammation of the liver.

4 0
3 years ago
How would you best describe a hypothesis?
tatiyna

Choice C. Educated guess or a prediction that can be tested, based on limited evidence.

5 0
3 years ago
What part of a tree conducts electricity when hit by lightning?​
Zielflug [23.3K]

Answer:

In most trees, the area just under the bark layer contains moisture in the form of sap and water. And since water is a better electrical conductor than wood, lightning striking a tree tends to travel just underneath the bark.

4 0
3 years ago
3. Are the backbones of the DNA molecule identical in all living things?
Deffense [45]
That answer would be no. because not all of them are the same.
4 0
3 years ago
Other questions:
  • Charles Darwin observed a unique beak size and shape in the finch population of each of the Galapagos Islands that he visited. m
    8·2 answers
  • White blood cells are the body's natural defenders against harmful invaders. One way white blood cells offer protection is by en
    12·2 answers
  • On a molecular level, all organisms
    15·1 answer
  • Which organ is responsible for manufacturing and secreting digestive enzymes and bicarbonate?
    9·1 answer
  • Which one of the following is a vitamin deficiency diseses<br>​
    8·1 answer
  • In the presence of lidocaine, the action potential was not affected at r1 because _______.
    9·1 answer
  • When a genetic mutation occurs, which part of the DNA changes?
    15·1 answer
  • Which label belongs in the region marked X?
    9·1 answer
  • Which organelles are different between animal cells &amp; plant cells? pls 45 minutes till this assignment is due
    12·2 answers
  • What are the function of cerculatory system
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!