1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melomori [17]
2 years ago
12

What does the respritory system do?

Biology
1 answer:
diamong [38]2 years ago
4 0

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

You might be interested in
PLEASE HELP!!!
Lera25 [3.4K]
The last one I think
4 0
2 years ago
Can someone pls help? Thx!!
Pachacha [2.7K]

he correct answer is number one. A chromosome is composed of many genes. A chromosome is referred to as a DNA molecule in an organism's body, which consists of genetic materials. Chromosomes consists of numerous genes within them, in their nucleus and mitochondria, genes are found inside the Chromosomes itself

4 0
2 years ago
Read 2 more answers
Explain how water is used to create electricity.
Kamila [148]

Answer:

Explanation:Flowing water creates energy that can be captured and turned into electricity.The most common type of hydroelectric power plant uses a dam on a river to store water in a reservoir. Water released from the reservoir flows through a turbine, spinning it, which in turn activates a generator to produce electricity.

7 0
2 years ago
Read 2 more answers
Why did Avery's group destroyed each type of molecule before adding it to the solution containing R bacteria? what can you concl
olya-2409 [2.1K]
Because that destroyed it so it could be more helpful
8 0
3 years ago
What type of simple machine will allow for mechanical advantage to increase as the length of the effort arm increases?
klasskru [66]

Answer:

Lever (b) is the correct answer

8 0
2 years ago
Other questions:
  • In the generation of most anions, the energy change (kj/mol) that _______ an electron is ________.
    9·1 answer
  • A female with unattached earlobes and a widow's peak hairline, and a male with attached earlobes and a widow's peak hairline hav
    10·1 answer
  • Biology is important in _____.
    8·1 answer
  • The classification levels of a human are listed below from largest to smallest.
    10·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Water has the ability to dissolve salts and carry dissolved carbon dioxide. How does this action help the human body maintain ho
    5·1 answer
  • Red blood cells _____. carry oxygen form clots carry carbon dioxide fight germs
    10·2 answers
  • NOT SURE IF THIS IS RIGHT PLEASSSEEEEWEEE HELPP
    7·2 answers
  • Which best describes the plant?
    7·1 answer
  • What is likely to happen when a cell dies in an adult multicellular organism?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!