1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lostsunrise [7]
3 years ago
14

Which of the following extremes would an organism that lives in the intertidal zone not be subjected to?

Biology
1 answer:
Svetach [21]3 years ago
6 0

Answer:

I believe your answer would be <u>high pressure</u> .

3.1 Air

3.2 Light

3.3 Temperature

3.4 Salinity stress

3.5 Desiccation stress

3.6 Predation

3.7 Wave action

Explanation:   High pressure is the only factor that is not included in this    chart of effects on organisms in the intertidal zone.

You might be interested in
Water moves from an area of 80% water to an area of 50% water is this active or passive transport
gavmur [86]
Passive because the water flow gets weaker mark brainliest please and have a good day
4 0
4 years ago
Read 2 more answers
Which plant tissue is responsible for transport
Katarina [22]
Xylem transports and stores water and water-soluble nutrients.
Phloem transports sugars, proteins, and other organic molecules.
3 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
A doctor is trying to diagnose a patient with short stature. She plots the girls growth in red on the growth chart below to comp
Pani-rosa [81]

B, an underactive pituitary gland

7 0
4 years ago
Please help me out, thank u.
goldenfox [79]

Answer:

Mineral C

Explanation:

Mineral C can scratch apalite, due to its higher hardness, but can be scratched BY feldspar due to it being slightly lower than feldspar.

5 0
4 years ago
Other questions:
  • 18. How do organisms grow?
    7·1 answer
  • What property do the following elements have in common? Sulfur, iodine, magnesium
    15·1 answer
  • Which is the most likely result of having a large number of biotechnology companies located in north carolina?
    8·1 answer
  • What is the function of cilia in the trachea?
    6·1 answer
  • 4. A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly In the mutant below, indicate the type of mu
    7·1 answer
  • Which substance do plant cell walls have that bacterial cell walls lack?
    7·1 answer
  • Substances intended for tubular reabsorption travel from the filtrate of the proximal convoluted tubule next to the ________.
    11·1 answer
  • Eukaryotic cells contain DNA in the mitochondria and chloroplasts (in addition to the nucleus). Is the organization of DNA in th
    13·1 answer
  • Devon is being treated for anxiety. he is connected to an instrument that records muscle tension. his job is to try to reduce mu
    13·1 answer
  • Which is a series of substances along which electrons are transferred, releasing energy?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!