1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
2 years ago
8

Which of these statements about fringe benefits are true

Law
1 answer:
LenKa [72]2 years ago
7 0
Employee wages do no include the value of any property or service that has so little value that accounting for it would be unreasonable or administratively impractical
You might be interested in
1. A statute is
aleksklad [387]

Answer:

I believe the answer to 1. is B, and Grare decisis means substantially the same. Basically based on a court's previous decision in a case, that same decision can be carried out and used in any future cases.

Explanation:

3 0
3 years ago
Read 2 more answers
What accurate conclusion can you say about necessary and proper clause ?
goldfiish [28.3K]

Answer:

necessary to balance proper exercise of the power

Explanation:

The term "Necessary and Proper Clause" was coined by Associate Justice Louis Brandeis in 1926. It is universally adopted by the courts in United States. It is also known as the "Elastic clause".

Necessary and Proper Clause: Article I, Section 8 of the United States Constitution

"The Congress shall have Power ... To make all Laws which shall be necessary and proper for carrying into Execution the foregoing Powers, and all other Powers vested by this Constitution in the Government of the United States, or in any Department or Officer thereof".

The clause gained prominence after Supreme Court's decision in <em>Lambert v. Yellowley </em>case. The court ruled in favor of restricting medicinal use of alcohol under the 18th Amendment. It was deemed necessary to balance proper exercise of the power.

It is a unique clause in American Constitution as it gives no absolute authority to any law rather it can be amended considering the seriousness of the situation. It makes the Constitution more flexible as well as a method to deal cases with immediate concerns.

7 0
3 years ago
Read 2 more answers
James is a lawyer who is representing a victim of domestic abuse in a case presided over by Judge Danner. During an unofficial c
Oksana_A [137]

Answer:

I would say this is unethical as it would be considered "ex parte".

Explanation:

4 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
Finish the lyrics
Ainat [17]

Answer:

A Earth?

Explanation:

'Cause you make my earth quake

Oh, you make my earth quake

Riding around, you tell me something, baby, and it's making my heart break

'Cause you make my earth quake

Oh, you make my earth quake (earth quake, yeah)

Riding around, your love is shakin' me up and it's making my heart break (you already know)

7 0
2 years ago
Read 2 more answers
Other questions:
  • Which action is an example of an "implied" power? (Congress) A- Congress votes to raise income taxes B- Congress holds an invest
    11·1 answer
  • Which of the following is not a polling error?
    13·2 answers
  • What policy/policies impact your life?
    10·1 answer
  • help, please please please please please please please please please please please please please please please please please ple
    10·2 answers
  • Name 2 things that Courts of Appeals use to limit the time spent on any given case.
    9·1 answer
  • What is the 7th amendment right in your own words
    5·1 answer
  • Owen is offered a contract to join a professional basketball team. He accepts their offer. What is TRUE about this acceptance?
    6·1 answer
  • Normally, both parties to a contract are discharged when they have completely performed their contractual
    5·1 answer
  • Be sure to answer at least one, or both, of the questions below in your response to the prompt. Explain your reasoning so that y
    12·1 answer
  • A new store has opened in town. There are special detectors Installed by the doors. If a security tag is not removed from an Ite
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!