1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin2010 [14]
2 years ago
13

Ano ang paksaang diwa ng balagtasan? Wala lang jowa​

Biology
1 answer:
Blababa [14]2 years ago
6 0

Answer: ?

Explanation:

You might be interested in
In the example of adrenaline signaling used in the animation, the signal is amplified in the activation of G protein, the produc
ahrayia [7]

Answer:

the answer is 1,000,000

6 0
3 years ago
The fossil record indicates that the earliest hominids most likely originated on which continent?
Brums [2.3K]
The fossil record indicates that the earliest hominids most likely originated in "Africa," since this is the location from which humans eventually migrated to other locations.
7 0
3 years ago
Which of the following is an example of an STD caused by a virus? 
Kamila [148]
Herpes would be one of them
8 0
3 years ago
Learning At Home - Grade 7/Pre-AP Gr. 7 Science TWISD
aliina [53]

Answer:

the dogs secure there offspring by getting them food

Explanation:

4 0
3 years ago
The first steps of catabolism generally take place in the
WINSTONCH [101]

The first steps of catabolism generally take place in the cytosol.

Glycolysis and pentose phosphate pathway are metabolic process that occurs inside of the cytosol. Other catabolic processes such as the citric acid cycle, electron transport chain, and oxidative phosphorylation all take place in the mitochondrial membrane.


7 0
3 years ago
Other questions:
  • Select all that apply. The five major striated muscle groups in the body are _____. neck arms chest abdominals hands legs back f
    14·2 answers
  • How does the United States limit the power of its government? i. Government officials are subject to the law. ii. Government off
    14·1 answer
  • What object is located at one foci of Comet Tempel-Tuttle’s orbit
    10·1 answer
  • Which best describes the geologic time scale?
    8·2 answers
  • What is Hyperthymesia ?
    12·2 answers
  • Seeds (dominant) and wrinkled seeds (recessive)
    8·1 answer
  • What is the passing of genetic information from one generation to the next?
    10·2 answers
  • What are the products of photosynthesis?
    13·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which characteristic belongs in the area marked X?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!