1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergejj [24]
3 years ago
15

Learning At Home - Grade 7/Pre-AP Gr. 7 Science TWISD

Biology
1 answer:
aliina [53]3 years ago
4 0

Answer:

the dogs secure there offspring by getting them food

Explanation:

You might be interested in
Aluminum is used to make cans for the beverage industry. In which other industries is aluminum important?
Verdich [7]

Answer:

D.

Explanation:

It's the only choice that has three things that are made out of aluminum.

<em>Hope this helps :)</em>

5 0
3 years ago
Which type of dating involves matching up layers of rocks from to different areas
d1i1m1o1n [39]

Answer:

D. Correlative​

Explanation:

7 0
3 years ago
Read 2 more answers
What are the factors that are tested by being varied by the experimenter?
grin007 [14]
Independent Variables are the factors that are tested by beingvaried by the experimenter.

Hope this helped. Have a great day! :D
3 0
4 years ago
Why is ocean layering different at the poles compared to the equator?
denis-greek [22]
The answer is B, because layers mix better at the poles.
3 0
3 years ago
Read 2 more answers
Which of the following is used in photosynthesis by both plants and cyanobacteria?
djverab [1.8K]

Answer:

a)Water, sunlight, and carbon dioxide

7 0
3 years ago
Other questions:
  • Witch two cellular structures have a role in the creation of proteins
    14·1 answer
  • On a hot summer day, Tameka spilled water on the sidewalk, but a few hours later there was no evidence of the water. What most l
    11·2 answers
  • A rock has a density of 20g/cm3 and a mass of 10g. What is the volume of the rock?
    11·1 answer
  • What cellular process makes most of a cell ATP!
    14·1 answer
  • The Sun is essential to life on earth. Which of the statements is not true about the Sun's importance to life on the earth?
    6·2 answers
  • Common symptoms of iron-deficiency anemia include muscle weakness, shortness of breath, and lightheartedness. Why does iron defi
    6·1 answer
  • Which of the following is consumed by producers?
    8·1 answer
  • Where does digestion take place
    12·2 answers
  • NEED ANSWER QUICK, WILL GIVE BRANLIEST!!!
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!