I think it is beneficial for the brain to be connected to the contralateral side of the body because of the position and connection to the brain that our eyes have. Because light from the right visual fields strikes the left side of the eye and light from the left side strikes the right side of the eye, the connections allow visual information from both sides of the body to reach the brain.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
?
Explanation:
I think you need to expand on this question
This happens because these regions are located further away from urban areas and the milk can easily get spoiled before it is delivered to the consumers. Therefore, dairy farms which are away from urban areas, process the milk in order to produce milk products that can last longer. Milk products such as butter or cheese can stay fresh for a longer period of time and they do not get spoiled before reaching the consumers. New Zealand is a place where this practice is quite common since it is located at a great distance from important markets, such as Europe and North America. Milk can be shipped at such a great distance only in the form of processed milk products.
