The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
<span>Spray auxin at the base of the rose cutting. Hope that helps :)</span>
The excess salt would be excreted in their urine
<span>Option (b) ammonites and belomites are two group of organisms that were commonly found during jurrasic period.</span>
Obtain energy for the cell
