1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erik [133]
3 years ago
8

What’s the answer!!! Help

Biology
1 answer:
shepuryov [24]3 years ago
8 0

last choices last dot Letter D

You might be interested in
Cellulose is found in the _______(this question regards organelles btw)
Triss [41]

It is found in the cell walls of plants.

4 0
3 years ago
Development of Male Gametophyte.
Paul [167]
Game to fight lol....
8 0
3 years ago
When a peer is in distress, children who are assertive react with a)lip biting. b)a rise in heart rate. c)an increase in eeg bra
nirvana33 [79]

Children who are assertive and good at regulating emotions are more likely to help,share and give comfort to others in distress. If a peer is in distress they will react by frowning,lip biting, comfort seeking,rise in heart rate, and a sharp increase in EEG brain-wave activity in the right cerebral hemisphere that contains negative emotions.

7 0
3 years ago
1. That structure that temporarily stores food in an amoeba is called the
Romashka-Z-Leto [24]
I learned that the answer is vacuole
7 0
4 years ago
Do tectonic plates move quickly or slowly?
Brilliant_brown [7]
Yep, very slowly but constantly shifting
3 0
3 years ago
Other questions:
  • Which sentence describes a sex limited trait?
    12·2 answers
  • Cara and Chuck were looking at pond water through a microscope. They saw small square crystals in their slide. Cara wondered wha
    12·2 answers
  • there are four trophic levels in a food chain: Algae, salmon, bears and humans. if algae produce 6500 kj of energy, calculate th
    14·2 answers
  • You decide to plant a garden in your backyard. You dig up a strip of grass in a sunny spot. When you have finished digging up th
    14·1 answer
  • Help me with 6-12 please
    6·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Plantas de herbolaria mexicana que usamos para calmar problemas digestivos??
    12·1 answer
  • Why are lab safety rules important? I’m currently doing an essay with minimum of 250 words. You don’t really have to do that but
    13·2 answers
  • Which increases when water freezes: its
    11·1 answer
  • Which is heavier, dry air or moist air? Why?<br><br> WILL MARK BRAINLIEST!!
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!