, the world was made up of a single continent through most of geologic
time. That continent eventually separated and drifted apart, forming
into the seven continents we have today. The first comprehensive theory
of continental drift was suggested by the German meteorologist Alfred Wegener
in 1912. The hypothesis asserts that the continents consist of lighter
rocks that rest on heavier crustal material—similar to the manner in
which icebergs float on water. Wegener contended that the relative
positions of the continents are not rigidly fixed but are slowly
moving—at a rate of about one yard per century.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
b. dred scott vs sandford
Explanation:
The correct answer is letter b.
It happened in 1857, when Dred Scott, an enslaved black man, whose owners had taken him from a slave-holding state to a slave-free state and then brought back to the slave-holding state. With this, he argued that since he was taken into free territory, he was legally free by the Constitution. The US supreme court then ruled that the constitution was not valid to a black person :(
