Answer:
predator is the dotted line, prey is solid.
Explanation:
predator eats prey therfore prey population goes down
I believe it is also B, I took biology last year
The reproductive cycle in females is regulated primarily by HER HORMONES. Five hormones to be exact. These hormones are Estrogen, Progesterone, Luteinizing hormone (LH), follicle stimulating hormone (FSH), and gonadotropin releasing hormone.
Estrogen is from the ovaries. It helps regulate the menstrual cycle. It promotes the rapid growth of cell linings in the uterus to prepare for implantation resulting to pregnancy.
Progesterone is also from the ovaries. It is produced after ovulation and maintains the health of the lining within the uterus during pregnancy. If no pregnancy occurs, the progesterone level decrease and results to menses or monthly period.
Gonadotropin Releasing Hormone is secreted by the brain as a result of the hormonal changes that occur every month. It in turn stimulates the production of FSH and LH.
FSH stimulates the follicles inside the ovaries increase the amount of estrogen and progesterone produced in the first two weeks of the menstrual cycle.
The increase in estrogen level by FSH prompts the pituitary glands to release LH. Luteinizing hormone then signals the dominant follicle, made by FSH inside the ovaries, to release its eggs for possible fertilization.
A major problem for anthropologists when they were just studying objects in museum collections was that the objects were viewed as isolated from their cultural context.
<h3>
What is Anthropology?</h3>
Anthropology is the scientific study of humans and includes the study of historical and contemporary human species as well as human behavior, biology, cultures, civilizations, and linguistics. While cultural anthropology examines cultural meaning, including norms and values, social anthropology explores patterns of behavior.
Today, the phrase sociocultural anthropology is frequently employed as a portmanteau. Language's impact on social life is the subject of linguistic anthropology. The biological evolution of people is studied in biological or physical anthropology.
Archaeological anthropology, sometimes known as "anthropology of the past," examines physical evidence to study human behavior. In North America and Asia, it is regarded as a subfield of anthropology, but in Europe it is viewed as a field unto itself or categorized under other related fields like paleontology and history.
Learn more about anthropology with the help of the given link:
brainly.com/question/14887941
#SPJ4
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
