1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brrunno [24]
2 years ago
11

Can someone please double-check these for me​

Biology
1 answer:
s344n2d4d5 [400]2 years ago
8 0

Answer:

you are right

Explanation:

You might be interested in
I didnt know if this is biology or physics but PLEASE HELP ME
Reptile [31]

Answer:

They would weigh 33 lbs.

Explanation:

have a good day!

5 0
2 years ago
After watching plants develop, Schleiden concluded that all parts of a plant are made from plant cells. Which tenet of the cell
Gennadij [26K]

All organisms contain cells

7 0
3 years ago
Can someone help me please this is due today I asked 3 times (monohybrid crosses)
7nadin3 [17]

Answer:

9. ff

10. Bb

12. Ee

13,ff

Explanation:

3 0
2 years ago
A scientist is comparing the outer layer of an onion cell to the outer layer of a human skin cell. What is unique about the oute
Gnoma [55]

Answer:

The onion cell has a cell wall, unlike the human skin cell.

Explanation:

Only plant cells have cell walls.

3 0
2 years ago
The fossils are found in wht tpye of rock
VashaNatasha [74]

hello

fossils, the preserved remains of animal and plant life, are mostly found embedded in sedimentary rocks. Of the sedimentary rocks, most fossils occur in shale, limestone and sandstone. Earth contains three types of rocks: metamorphic, igneous and sedimentary.

Have a goed day

8 0
2 years ago
Read 2 more answers
Other questions:
  • Would happen to the human population if endosperms were not a source of food.
    11·1 answer
  • HELPPPPPPP CHECK .................
    7·2 answers
  • What structure keeps food and water from entering the frog's lungs?
    11·1 answer
  • Are viruses alive? This question is debated among scientists throughout the world. Consider the following passage. Scientific re
    10·2 answers
  • Which organism is a producer?
    12·2 answers
  • A depression in the ground due to a cave collapse or acidic water dissolution of limestone is called a
    11·1 answer
  • During El Niño, warm water moves from Australia to the coast of South America. Which change does this cause to Australia?
    15·1 answer
  • While playing soccer in your backyard, you disrupt a small fire ant mound. The fire ants emerge and bite your feet. Your feet be
    15·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • How is your heart like a water bottle that has to be squeezed for the water to come out​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!