1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
6

As an instructor for a class that assists individuals to become Master Gardeners, you are charged with answering the questions a

nd addressing the concerns of your students. A student asks about an angiosperm plant called Sweet William (Dianthus sp.) that he added to his garden last year. He is concerned because it did not flower last year, and although it is early in the spring season, he has not seen flower buds on it this year. You immediately recognize that there is nothing amiss with this angiosperm plant, and you tell your student:__________
1. this plant is a perennial, so it must have produced flowers very early in the season last year.
2. this plant is an annual, so it does not produce flowers.
3. this plant is a perennial, so it will only produce flowers once in its lifetime.
4.this plant is a biennial, which means it will just take longer than a season to mature enough to produce flowers.
Biology
1 answer:
Snezhnost [94]3 years ago
6 0
<h2>Biennial plants</h2>

Explanation:

This plant is a biennial, which means it will just take longer than a season to mature enough to produce flowers.

Since the Sweet William  plant did not flower last year when it was planted and this year also it did not bud till the spring. So, we can assume that these plant will need atleast two seasons to mature hence they are biennials.

Depending on the life span, plants are classified as annuals (one season), biennials(two season) and perennials (more than two years).

You might be interested in
A cylindrical blood vessel is partially blocked by the buildup of plaque. at one point, the plaque decreases the diameter of the
Aleksandr-060686 [28]

Answer:  It will slow down.

Explanation:  This is because the same amount of blood that usually goes through will have to fit through a blocked vessel.  Only a little will be able to go through at one time, causing the blood flow on the other side to slow.

(That is really dangerous.  The build-up will eventually burst the vessel)  Just an FYI

7 0
3 years ago
Please help, online school is sucking rn :(
gayaneshka [121]
I feel you the first one
3 0
2 years ago
How many genes are shared by all viruses?
Dominik [7]

Answer:

200 approximate

Explanation:

depends how many in common

5 0
2 years ago
Bleaching is caused by the addition of bleach containing fertilizers that enter marine systems through runoff. True False
julsineya [31]

Answer:

False

Explanation:

6 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • The chemical stockroom also contains a solution labeled unknown. This solution contains a 0.10M solution of a "synthetic base".
    13·1 answer
  • A controlled experiment allows the scientist to isolate and test___________.a.a conclusion.b.a mass of information.c.several var
    10·1 answer
  • Staphylococcus aureus has become resistant to penicillin, methicillin, and now possibly to vancomycin. Since bacteria do not sex
    11·1 answer
  • I am the first consumer above the producer level. I am a
    7·2 answers
  • Arrival of the electrical impulse causes neurotransmitters to diffuse across the _______ and bind to the next cell.
    13·1 answer
  • If the Sun uses up its hydrogen, what will happen to the Sun?
    11·1 answer
  • Which of the following correctly describes the process of DNA replication in the lagging strand?
    15·2 answers
  • Which TWO digestive juices are secreted into the duodenum? ​
    8·2 answers
  • If an owl eats a mouse that eats grass, the owl is a
    7·2 answers
  • What percentage of Earth’s surface is covered by water?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!