1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
2 years ago
11

What is the correct answer?

Biology
1 answer:
ch4aika [34]2 years ago
8 0

Answer:

Friction

Explanation:

There u go

You might be interested in
Most fungi live by decomposing the remains of plants, animals, and microbes found in soil. that is why most fungi are called
zysi [14]
Most fungi arw called saprophytes
6 0
3 years ago
Name the process responsible for the formation of glomerular filtrate<br>​
STatiana [176]

Answer: Please refer to:

The process by which glomerular filtration occurs is called renal ultrafiltration. The force of hydrostatic pressure in the glomerulus (the force of pressure exerted from the pressure of the blood vessel itself) is the driving force that pushes filtrate out of the capillaries and into the slits in the nephron.

Explanation:

Not sure but hope it helps.

4 0
2 years ago
One of the first scientists of the Renaissance to advance taxonomy through firsthand observations was _____.
Fed [463]
Alright bud the best answer to this question would be that one of the first scientists of the Renaissance to advance taxonomy through first hand observations was Cordus 
6 0
3 years ago
What's the opposite of 0.5
lions [1.4K]
The answer would be -0.5
5 0
3 years ago
Which of the following is NOT a limiting factor for animals in an ecosystem?
TEA [102]

Answer:

4

Explanation:

because it needs all the other stuff

6 0
1 year ago
Read 2 more answers
Other questions:
  • What's the answer to this question
    7·1 answer
  • Describe the type of attitude that would help of attitude that would help to make a good scientist?
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • if a gas has a volume of 1L at a pressure of 270 kPa what volume will it have when the pressure is increased to 540 kPa. Assume
    13·1 answer
  • A ____ reaction is a reaction that occurs between two aqueous solutions that results in the formation of a solid compound
    7·1 answer
  • What is your goal if you're going to diet? To lose weight or to lose mass? Why?
    7·1 answer
  • Which of the following Venn diagrams would BEST be suited to represent the three categories of animals?
    15·1 answer
  • What is the main problem associated with metal refining?
    6·2 answers
  • How does phosphorus (in the form of phosphate) originally move through the<br> community?
    7·2 answers
  • Match each term to its description.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!