1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mazyrski [523]
2 years ago
5

Two ladders are leaning against a building, forming two similar triangles as shown below. The top of the longer ladder is 28 fee

t up the building's side. The top of the shorter ladder is 20 feet up the building's side and its base is 15 feet from the bottom of the building. What is the length of the longer ladder?
Mathematics
1 answer:
postnew [5]2 years ago
7 0

Answer:

The length of the longer ladder is 35 ft

Step-by-step explanation:

Please check the attachment for a diagrammatic representation of the problem

We want to calculate the length of the longer ladder ;

We make reference to the diagram

Since the two right triangles formed are similar. the ratios of their sides are equal;

Thus;

20/15 = 28/x + 15

20(x + 15) = 15(28)

20x + 300 = 420

20x = 420-300

20x = 120

x = 120/20

x = 6

So we want to calculate the hypotenuse of a right triangle with other sides 28ft and 21 ft

To do this, we use the Pythagoras’ theorem which states that square of the hypotenuse equals the sum of the squares of the two other sides

Let the hypotenuse be marked x

x^2 = 28^2 + 21^2

x^2 = 1,225

x = √1225

x = 35 ft

You might be interested in
I will give the BRAINIEST <br><br> Find the values of x and y in the diagram below
Brrunno [24]

:=4  Y=3

-Lanaya- AT your help- Happy to help!

8 0
3 years ago
Read 2 more answers
A student said that x = 4 was not a solution to the question 3(x -6) = -8
Morgarella [4.7K]

Answer:

Step-by-step explanation:

3 (4 -6) = -8 is correct.  The next step is to combine 4 and -6, obtaining

3(-2)

and this 3(-2) should equal -6, which is not the same as -8.

3(4 - 6) = 12 - 18, which differs from the student's solution.  This is the reason for the wrong answer.

6 0
3 years ago
Please get this problem correct. Please explain and make it easy to understand.
mezya [45]

<u>9</u><u> </u><u>is</u><u> </u><u>a</u><u> </u><u>solution</u><u>.</u>

Answer:

Solution given:

2x+10=28

subtracting both side by 10

2x+10-10=28-10

2x=18

dividing both side by 2

2x/2=18/2

x=9

4 0
3 years ago
Read 2 more answers
Solve the equation: 3x + 5 = 17<br><br> Can you please help me?
Talja [164]

Answer: x=4

Step-by-step explanation: Look at pic below to see how solved.

7 0
3 years ago
Match the equation with its graph . identify the slope and y-intercept y= -2/3x+1
harkovskaia [24]

Answer:

the slope is -2/3x and the y intercept is 1

Step-by-step explanation:

3 0
3 years ago
Other questions:
  • Choose the inequality that illustrates this problem. After serving 45 pounds of poultry, a caterer had more than 10 pounds left.
    11·2 answers
  • PLEASE HELP PLEASE PLEASE HELP
    5·2 answers
  • 82- what number-33=35
    13·1 answer
  • Broccoli cost $3.14 a pound at the market. If Tyrell<br> bought 3.5 pounds, what was the cost?
    7·2 answers
  • A 50-ft x 300-ft parking lot is divided into sections for a craft fair by bisecting the width and the length. Each half is again
    14·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • In an effort to prepare for retirement, Zeus decided to sell off some of his powers to Poseidon. Each box of powers contained 4
    12·1 answer
  • What is the area of the figure below in square centimeters?
    15·1 answer
  • First person to answer both of these will get 10 points and Brainliest. But your answer has to be correct!​
    10·2 answers
  • If it’s 1 pm what time will it be in 30 hours
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!