1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulsSmile [24]
3 years ago
11

Leigh's disease is a mitochondrially inherited disease with symptoms that include seizures, fatigue, impaired reflexes, breathin

g problems, and ataxia. The pedigree shows the presence of Leigh's disease in three generations. Individual 4 had two daughters and one son, and individual 6 had one daughter and two sons. Which of the individuals indicated are affected by Leigh's disease
Biology
1 answer:
Ahat [919]3 years ago
5 0

About the question:

You will find the pedigree in the attached files

Answer:

  • individual 4 → Affected woman → Black circle
  • individual 5 → Affected woman or man → Black circle or square
  • individual 7 → Healthy woman → Empty circle
  • individual 10 → Affected boy → Black Square

Explanation:      

Mitochondrial inheritance is the transmission of a disease or a trait from the maternal line.

<em>Most of the DNI is in the nucleus, but there is also DNI in mitochondria. Sperm cells hardly transfer mitochondrial genes to the progeny</em>, so mitochondrial DNI is mostly inherited from the maternal side. If there exists any mutation in this mitochondrial DNI, the whole progeny of the mutated woman will be affected, as they will get the mother genotype carrying the mutation. On the contrary, if an affected man is carrying a mutation in mitochondrial DNI, non of their descendants will get the disease.

Before answering the question, let us remember the pedigree symbols.

  • Squares represent Males/Men
  • Circles represent Females/Women
  • Empty symbols represent healthy/non-affected individuals
  • Solid black symbols represent sick/affected individuals

In the exposed pedigree, we can see that the mother is affected by the disease (individual number 2), so all her children are also affected (individuals 4, 5, and 6) because the <em>disease is mitochondrially inherited</em>.

Individual 3 is a healthy man, so individual 4 must be an affected woman (Black circle). As she is the one affected, then all her children will also be affected. This couple <em>had one boy and two girls</em>. Individuals 8 and 9 are girls (circle), so individual 10 must be the affected boy (black square).  

On the other hand, individual 6 is an affected man (black square), son of individuals 1 and 2. This man couples with a woman, and they have all healthy children. So this woman (individual 7) must be healthy. Even though the man is affected, all their children are not because their mother (7) is not. Remember that sperm cells do not transmit the mitochondrial genes to the progeny.      

And finally, individual number 5 might be either a man or a woman. In any case, this person is also affected by Leigh's disease.  

You might be interested in
If the original cell
Kisachek [45]
30

Step by steps explanation
8 0
3 years ago
Describe the structure of a protein
velikii [3]

Answer:

Peptide bonds and Amino Acids

Explanation:

Primary structure. The primary structure of a protein refers to the sequence of amino acids in the polypeptide chain. The primary structure is held together by peptide bonds that are made during the process of protein biosynthesis.

5 0
3 years ago
The diagram shows the structure of an organelle known as the powerhouse of the cell. This organelle is responsible for releasing
JulijaS [17]
Answer:
Mitochondria
Explanation:
Its the powerhouse of the cell
4 0
2 years ago
Read 2 more answers
What are the products of photosynthesis?
ycow [4]
Answer : Glucose and oxygen

Explanation : The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.
8 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Which is a frameshift mutation?<br> a.)substitution<br> b.)nonsense<br> c.)silent<br> d.)deletion
    16·2 answers
  • Phytophthora infestans is an organism that causes the serious potato disease known as potato blight. The effect of Phytophthora
    8·1 answer
  • The distance between Neptune and the Sun is 30.06 AU. What is this distance in millions of kilometers? (One AU is about 150 mill
    12·2 answers
  • The health of a watershed cannot be indicated by the number and diversity of organisms.
    11·2 answers
  • Which of the following statements is false? A. The primary electron acceptor is found in the reaction-center complex of a photos
    7·1 answer
  • Which bases are found in a strand of dna? thymiwhich bases are found in a strand of dna?
    10·2 answers
  • What scientist thought he proved that plants obtain nutrients from water rather than soil
    5·1 answer
  • what is believed to be the first type of cells on earth? a. tree cells b. eukaryotic cells c. prokaryotic cells d. plant cells
    14·1 answer
  • Are ribosomes the food for a plant cell?
    14·2 answers
  • Which of the following functions in multicellular organisms is similar to the function of DNA in unicellular organisms?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!