1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viktelen [127]
2 years ago
7

Can anyone help me with a test It’s science

Biology
1 answer:
Fed [463]2 years ago
5 0
Yeah where’s the picture?
You might be interested in
What are two examples of organisms competing for a shared resources?
Katen [24]
Lions and tigers competing for an antelope.
5 0
3 years ago
Streamlining a car or boat can increase speed by decreasing friction. True or False
Fofino [41]
The answer to this is true

7 0
3 years ago
Read 2 more answers
Can you help me due pass the regents science
natulia [17]
SI pasala :) te ayudare :3

7 0
3 years ago
When analyzing three genes that reside on the same chromosome, the expected frequency of double-crossover events can be determin
statuscvo [17]

Answer:

The answer is positive interference

Explanation:

8 0
3 years ago
Consider the following genetic problem dealing with cystic fibrosis, which is a recessive trait (disease). We will use B to repr
bezimeni [28]

Answer:

B. BB, BB, Bb, Bb

Explanation:

Man: BB

Woman: Bb

8 0
3 years ago
Other questions:
  • What is another word for bacteria ?
    15·1 answer
  • Is a mushroom Eukaryotic or prokaryotic? why?
    9·2 answers
  • What characteristics are used to describe a population?
    15·1 answer
  • In contrast to eukaryotic cells, prokaryotic cells
    11·1 answer
  • What is the function of the type of muscle that is pictured below?
    5·2 answers
  • Over time, a tadpole changes into a frog. Has it evolved?
    8·2 answers
  • Which gas is responsible for global warming and which gas is responsible of ozone layer depletion
    10·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Form a Hypothesis: As the map shows, the sickle cell allele is not found in African populations that are native to southern Afri
    15·1 answer
  • How many palindromic years will there be in the twenty_first century?​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!