The high heat capacity of water prevents fish body temperatures from changing during the winter.
Answer:
features of living things are -
☆ they can grow and repair
☆ they can respire
☆ they can reproduce
Examples - humans , animals , etc.
hope that helps uhh :)
I believe all of these answers are correct. <span>Proteins
play a key role in cell differentiation. The external environment,
specifically temperature, during the development of turtles and some
other reptiles helps to determine the sex of hatching offspring
Different transcription factors are associated with the differentiation
of stem cells into bone, muscle,
and nerve cells. Transcription
factors bind to regulatory regions of a gene and affect their
expression. The amount of available light or day length helps to
determine the
patterns of gene expression
that lead to flowering in
some plants.
</span>
Answer:
Explanation:
a. The template strand is:
ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT
The coding strand is
TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA
The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'
b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'
c. N terminus Met-Val-Arg-Ser-Asp C terminus
d. GGAGGA
e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.
women and girls in India and other nearby countries where dowry is still prevalent. Dowry can put great financial burden on low income families. Often times, instead of being a gift, it more of a demand from bridegroom's family.
Dowry system can also lead to many unwanted situations
