1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anuta_ua [19.1K]
3 years ago
13

Both coral reefs and wetlands have been destroyed by _____.

Biology
2 answers:
Dvinal [7]3 years ago
3 0
Tornados and hurricanes
prisoha [69]3 years ago
3 0
I would say pollution. Pollution destroys many different ecosystems. 
You might be interested in
Describe the movement of water molecules in this diagram and identify the state of the solution. Explain why the water molecules
Soloha48 [4]

Answer:

the answer is they move freely

Explanation:

6 0
3 years ago
Read 2 more answers
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
A couple seek molecular testing for prenatal diagnosis of an autosomal recessive condition. the haplotype in coupling with the m
g100num [7]
<span>the most likely diagnosis for the fetus regarding the condition is Heterozygous carrier.It means having two unique alleles at relating loci on homologous chromosomes. A person who is heterozygous for a characteristic has acquired an allele for that quality from one parent and an elective allele from the other parent.Inheritance of the maternal mutant haplotype predicts that the fetus is a carrier</span>
5 0
3 years ago
What benefit(s) can commanders derive from the myriad of players and information flows that make up the complex operational envi
nadezda [96]
The benefits which commanders derive from the myriad of players and information flows which make up the complex operational environment is

the experience, perspectives and expertise can be leveraged through collaboration and dialogue among many players.
5 0
3 years ago
Which stores the most energy
worty [1.4K]

Answer:

one gram of fat

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Approximately how long has the victim been dead if his body temperature was 78.6°F?
    5·1 answer
  • Reptiles are ectothermic yet they must still be able maintain a relatively high internal body temperature in order to function p
    8·1 answer
  • Clotting is necessary to mend breaks in circulatory vessels and to prevent extreme losses of blood, but it can also have detrime
    13·1 answer
  • What are the images that occur when a visual sensation persists for a brief time even after the original stimulus are removed?
    8·1 answer
  • Choose the incorrect statement concerning centrioles.
    9·2 answers
  • Which of the following statements about facilitated diffusion is true?
    8·1 answer
  • Which is not a type of plant tissue
    15·1 answer
  • It is mistakenly believed that the rapid evolutionary changes of punctuated equilibrium are the result of some mechanism of evol
    12·1 answer
  • 100 POINTS
    9·1 answer
  • As a puppy, Cricket weighed 334 pounds. At her 1-year check-up with the vet, Cricket weighed 12.5 pounds.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!