1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elodia [21]
3 years ago
8

1. Which type of soil does Kenneth have?

Biology
2 answers:
Blababa [14]3 years ago
7 0

Answer:

homie got dirt

Explanation:

VLD [36.1K]3 years ago
4 0
Do you have a pic or description of the soil?
You might be interested in
Para a ocorrência de osmose, é necessário que (analise as afirmações a seguir e marque como resposta a soma dos itens corretos u
mixer [17]

Answer:

(08) and (32)

Explanation:

To make osmosis happen there has to be a difference in the concentration of solutes, between the inside and the outside of the cell. To valance this difference in concentration, water has to flow towards a place that has a higher number of solutes.

The lipids in the cell's wall make this membrane semipermeable. This allows the passage of specific components only, such as water through aquaporins. Lipids and other elements are of importance in the barrier because they maintain the cell separated from the outside, allowing it to be balanced as regards the different substances that can interact with it.

6 0
3 years ago
What is phylenogeny?
skad [1K]

Answer:

the branch of biology that deals with phylogenesis

Explanation:

another term for phylogenesis

3 0
3 years ago
Read 2 more answers
You are an expert paleontologist reviewing the work of Professor Bonefinder, who recently discovered the remains of a primate fo
sergeinik [125]

Answer:

The professor Bonefinder has made a mistake.

Explanation:

I't is true the Hominoid had a long snout, a large orbits that are partially enclosed, but they have no tail. This point is really critical because the morphology of an species is really important. The taxonomists use the information that morphology gave for many years to identify species, nowadays with molecular techniques some of those species are pulled apart, but the important matter is that hominoids had no tail.

So the professor Bonefinder analysis is incorrect because the hominoids have no tail.

3 0
3 years ago
Suggest why anaerobic respiration can only be<br>sustained for short periods of time.​
aleksklad [387]
Anaerobic respiration can be sustained for short periods of time because you aren’t using oxygen. We need oxygen in our body to work our muscles and pump our heart.
6 0
3 years ago
What can you tell about Jupiter from the diagram of the planets? A) It has more moons than Earth does. B) It is colder there tha
Firlakuza [10]
Where’s the diagram picture I won’t be able to answer if I’m not sure
6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What type of cell reproduction has gametes? a. fusion b. asexual c. budding d. sexual
    11·1 answer
  • Differentiate between pseudoscience and science
    12·2 answers
  • Which of the following is known as the powerhouse of the animal cell? endoplasmic reticulum, Golgi apparatus, mitochondrion or n
    10·2 answers
  • The diagram represents one of Mendel’s laws or principles of inheritance. F 1 includes Upper G g and Upper G g. F 2 includes Upp
    14·2 answers
  • Define disaccharide and provide two examples​
    6·1 answer
  • To which region of the periodic tabled does this image correspond
    10·1 answer
  • A tube called the what extends from the bladder to the outside of the body
    9·1 answer
  • What is aerobic respiration?
    5·1 answer
  • Type of potential energy stored in bonds between atoms
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!