1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksenya-84 [330]
4 years ago
8

Label the producers, primary consumers, and secondary consumers in this ecosystem.

Biology
2 answers:
alukav5142 [94]4 years ago
5 0

Answer:

The producers would be the plants, or any organisms that earn energy directly from the sun. The primary consumers get their energy from eating producers. The secondary consumers get their energy by eating the primary consumers.

Explanation:

oksano4ka [1.4K]4 years ago
3 0

Answer:

Producers: The organism that produces a product.

Primary consumers: The first organism that gets the product.

Secondary consumers: The second organism that gets the product.

You might be interested in
Evergreen coniferous tree with red berries
N76 [4]
How is his a question???
5 0
3 years ago
Question 10<br><br> If you see caribou, lynx, bears, and conifers, you are probably in
lesantik [10]

Answer:

great danger

beacause lynx and bears can eat you alive

3 0
3 years ago
The data above represent the results of three different crosses involving the inheritance of a gene that determines whether a ce
prohojiy [21]

Answer:

The statement that best explains the mechanisms of inheritance of gene "The allele for blue is an X-linked dominant allele because there are no blue male offspring in cross 2."

Explanation:

The mechanism for inheritance of gene is the condition, in which the mutation when happens in one allele and cause the effect in the relevant phenotype. Similar inheritance will also be seen when the mutated allele will produce new type of the protein which will have deletorious effect on the normal function of the cell. In case of the single gene, autosomal dominant, autosomal recessive, X-linked dominant, X- linked recessive and mitochondrial are modes of inheritance.

4 0
4 years ago
It extends the vertebral column<br> a. Erector spinae<br> b. Vastus lateralis
AveGali [126]

Answer:

The Erector Spinae

Explanation:

5 0
4 years ago
Which book by timothy leary served as a guide to the experimental use of acid?
stepladder [879]

The Psychedelic Experience, served as a guide.

7 0
4 years ago
Other questions:
  • Increased interconnections among countries that occur with globalization make it:
    9·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which type of macromolecule stores genetic info
    11·2 answers
  • Researchers have found that plants can help to reduce various emissions, including carbon dioxide, because plants convert carbon
    8·2 answers
  • In a bean plant, which reaction will release the greatest amount of energy
    8·1 answer
  • Explain the differences in the vocabulary words given below. Then explain how the words are related. Use completed sentences in
    5·1 answer
  • Which of the following are part of the anthophyte life cycle? a. haploid cells b. diploid cells c. meiosis d. all of the above
    5·1 answer
  • The carbon that plants need for photosynthesis comes from... A. carbon molecules dissolved in water. B. carbon dioxide gas in th
    12·2 answers
  • Blood from all the parts of the body except the lungs goes to the _____ of the heart​
    14·2 answers
  • As you enter the locker room at the college gym, you notice the sharp, distinctive smell of chlorine from the adjacent swimming
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!