1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexandra [31]
2 years ago
15

PLEASE HURRY!!!!!!!!!!!!!

Biology
1 answer:
DENIUS [597]2 years ago
7 0

Answer:

D

Explanation:

Seeing as the gene is dominate, the hair would still be white evening it's Ww. For the hair to be a different color both parent would need a recessive gene (w), though neither does, meaning all the kids would have white hair.

You might be interested in
Viruses are different from bacteria in that
labwork [276]
Viruses are smaller than bacteria and need a living host
7 0
3 years ago
Read 2 more answers
In mitosis of a single cell, the nucleus
exis [7]
In mitosis of a single cell, the nucleus B) splits into two.
7 0
3 years ago
Which of the following is an example of diffraction?
makkiz [27]

<u>Answer:</u>

You try to pick up a shell in the water but it isn't where it appears to be is an example of diffraction

<u>Explanation:</u>

Diffraction refers to the light bending that happens as the light passes about the edge of some object. How much bending takes place is found by the size of wavelength of light relative to that of opening. If the opening is larger than the wavelength of light, then bending will not be noticeable.

Since, light gets diffracted due to water hence the shell kept inside the water appears to be at a different position than where it actually is

8 0
3 years ago
How does CO2 get Into the water from the atmosphere?
hichkok12 [17]
Through the carbon cycle and ocean acidification
7 0
2 years ago
A cell with six chromosomes undergoes mitosis how many chromosomes does each daughter cell have
Semenov [28]

Answer:

I may be wrong

Explanation:

But they have 46 chromosomes

3 0
3 years ago
Read 2 more answers
Other questions:
  • A pea plant has a tall stem. What are it's possible genotypes
    7·1 answer
  • Sicl4(I)+ h20(I) sio2(s) +HCI(aq)
    10·1 answer
  • What happens to proteins as they pass through the golgi apparatus?
    9·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Compare the organization of DNA in prokaryotic and eukaryotic cells
    6·1 answer
  • Which describes oxygen content as Earth evolved over time? Oxygen levels sharply declined about 400 million years ago. Oxygen le
    8·2 answers
  • What are the roles of Hydrogen peroxide, oxygen, hydrogen and catalase
    10·2 answers
  • What does DNA use to store information​
    8·1 answer
  • Name 3 sources of CO2.
    11·1 answer
  • What is the role of chlorophyll is photosynthesis?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!