1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dimulka [17.4K]
3 years ago
8

What is the purpose of setting a deadline for a goal

Health
2 answers:
KiRa [710]3 years ago
8 0
So you will push yourself more then ever to get there before the deadline 
nirvana33 [79]3 years ago
4 0
So that you can strive to do it and see how well you did it.
You might be interested in
Respect and confidence can be shown through which type of nonverbal expression?
Olenka [21]

Answer:

eye contact

Explanation:

5 0
3 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
Overconfidence refers to the tendency to Group of answer choices cling to our initial beliefs, even though they have been proven
Anastasy [175]

Answer:

underestimate the extent to which our beliefs and judgments are wrong.

Explanation:

Overconfidence effect:-

This effect is the well-established bias effect in which the subjective confidence of the person in his/her judgements is greater than objective accuracy of these judgements when the confidence is high especially. It is an example of the miscalibration of the subjective probabilities.

Hence, the correct option is - underestimate the extent to which our beliefs and judgments are wrong.

6 0
4 years ago
8. What is the highest signal number can be
sveta [45]
I think b but i could be wrong
3 0
3 years ago
Which of these is the best source of information about a health product?
Lapatulllka [165]
C- empirical evidence (Apex)

4 0
3 years ago
Read 2 more answers
Other questions:
  • ________are needed by the body in large amounts in order to maintain good health. macro-elements trace elements sugars
    8·1 answer
  • ........................................
    8·1 answer
  • Research indicates that generativity generally increases in middle age.
    14·1 answer
  • How can doing something for someone else help to relieve stress?
    14·1 answer
  • The study of the human muscles
    9·2 answers
  • After recovering from a stroke, Farina was able to learn how to hit a tennis ball. She is unable, however, to learn and remember
    12·1 answer
  • HELP ILL GIVE YOU BRAINLIST
    10·2 answers
  • Hey I just wanted to say that for all of you that have veteran family or have lost veteran family that they are appreciated by m
    11·1 answer
  • What causes a star to shine brightly?
    8·2 answers
  • Smoking has been commonly knowit to cause health problems since the 1920s.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!