1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verdich [7]
3 years ago
15

*

Biology
1 answer:
Gekata [30.6K]3 years ago
4 0
A. Metabolic

Hopes it help
You might be interested in
Parts of the eukaryotic cell worksheet answers​
love history [14]
Idk what school is it
7 0
3 years ago
Label the following statements as characteristics of the central or peripheral nervous systems:
zloy xaker [14]

Explanation:

peripheral, peripheral nervous system, central nervous system, central nervous system, peripheral

7 0
3 years ago
Despite reading numerous research studies that report the association of fast food consumption with heart disease and diabetes,
disa [49]

Answer:

Belief perseverance

Explanation:

Belief perseverance can also be referred to as belief persistence; it is the tendency for an individual to hold to his/her own initial belief in something despite receiving a new information that debunks the basis of one's initial belief.  An individual prefers to discredit the new belief despite sufficient evidence to discredit one's initial belief, just because they misinterpret or totally see no significance on the new information that was received.

Rachael's thinking of fast foods of being harmless, despite the information that fast foods are harmful is called belief perseverance.

8 0
4 years ago
Read 2 more answers
Please help answer the question depicted above <br> (the subject is earth science)
e-lub [12.9K]
#1 should be your answer!
6 0
3 years ago
PLZ HELP I NEED THIS PLZ IM BEHIND!!!!!!
rodikova [14]

Answer:

We were all ranked together at the valuation. Men and women, old and young, married and single, were ranked with horses, sheep, and swine. There were horses

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which activity do all living things do to survive? Carry out photosynthesis Take in energy reproduce hunt for a mate
    10·1 answer
  • Which fossils do invertebrate paleontologists study?
    9·2 answers
  • in 2002, the fossil of a four- winged dinosaur was discovered in china and named a microraptor. what was the significance of the
    7·1 answer
  • In many humans exposing the skin to sunlight or a prolonged period of time results in the production of more pigment by the skin
    8·1 answer
  • How do vestigial structures demonstrate common ancestry?
    5·1 answer
  • What type of cat lives in the canopy of the rainforest and what does it like to eat?
    8·1 answer
  • PLEASE HELP!!<br><br> What is the function of the meristematic tissue, and where is it located?
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Discuss why teenagers’ understanding of death is not yet fully mature.
    12·1 answer
  • The trapezius is a(n) _____ to the pectoralis major.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!