1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babunello [35]
3 years ago
13

What are the end results of translation?

Biology
1 answer:
Burka [1]3 years ago
5 0

Answer:

Proteins

Explanation:

You might be interested in
The building blocks of nucleic acids are ________.
jeyben [28]

Answer: The correct answer is nucleotide.

Explanation:

Nucleic acids are the polymer of nucleotides which are attached with each other with the help of phospho-diester bonds.

Nucleotide consists of sugar (ribose in RNA and deoxyribose in DNA), phosphate group, and nitrogenous base (A, T, G, and in DNA; and A, U, G, and C in RNA).

5 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
The food web illustrated above shows plants and animals, but does not indicate bacteria. If bacteria were truly missing from thi
Oksanka [162]

Answer: everything that died would not decompose. And that would affect the entire community

Explanation:

8 0
3 years ago
The area of the cortex that is responsible for sensations of the full bladder and the feeling that your lungs will burst when yo
Olegator [25]

Answer:

Insular cortex

Explanation:

The insular cortex is found in the visceral sensory area and receives sensory input from the thalamus to the CNS. They play a role in emotions including self awareness, motor control etc and they also play a part in the regulation of the body's homeostasis.

7 0
3 years ago
Because flamingos spend most of their time in water, heat is easily lost through their legs and feet. Scientific studies have su
Marat540 [252]

Answer:

Body temperature

Explanation:

Based on the first sentence, "Because flamingos spend most of their time in water, heat is easily lost through their legs and feet."

This question has to do with body temperature.

4 0
3 years ago
Read 2 more answers
Other questions:
  • HELPPP ASAP! TIMED! 10 MINUTES LEFTT! How is cold front formation different from stationary front formation?
    9·1 answer
  • Which country has the largest population of feral camels?
    13·2 answers
  • Number of cell divisions in process of mitosis
    13·2 answers
  • Select all of the following that plants
    7·1 answer
  • What processes enables lumber to be a self-maintaining renewable resource?
    12·1 answer
  • Which pressure is associated with blood flow to organs?
    5·1 answer
  • Why are snakes’ scales and birds’ feathers regarded as homologous structures?
    10·1 answer
  • Discuss the causes and effects of veld fire and suggest practical solutions
    11·1 answer
  • Faris and his wife have normal skin color, but they both have a parent with albinism if
    15·1 answer
  • Cell division involves
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!