1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mihalych1998 [28]
4 years ago
15

please!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

!!!!!!!!!!!!!!!!!!!

Biology
2 answers:
postnew [5]4 years ago
6 0

Answer:

the first is embro the second is compartative anatomy

, molecular and development.Explanation:

Scilla [17]4 years ago
3 0
1. Embryology
2. Comparative Anatomy
3. Molecular Biology
4. Developmental Biology
IM 90% sure that these are the right answers
You might be interested in
If a haploid cell has 50 chromosomes how much would the sex cell of the organism have?
Hitman42 [59]
25 !!!!!!!!!!!!!!!!!!!!
6 0
3 years ago
Read 2 more answers
Subject : Earth Science
garri49 [273]

1.

Identify the type of precipitation that is not one of the main categories.

snow

sleet

<em>drizzle</em> ✓

hail

  • It's a a mild fall of drops condensed hence , it's not a main category
  • The four main categories are snow ,rain ,sleet & hail

2.

Which device is used to measure rainfall?

measuring stick

rain gauge ✓

rain meter

rain stick

  • It calculates the precepated rain in a time period per unit area

3.

Which device is used to measure snow?

rain gauge

measuring stick ✓

measuring gauge

rain meter

  • A simple measuring stick can measure the thickness of snow
4 0
2 years ago
How have human populations used surface currents over time?​
Nonamiya [84]

Answer:

Changes in land use through time with extrapolations

Explanation:

Population data and projections are from UNDP

7 0
3 years ago
Among the tasks in coping with life-threatening illness described by kenneth doka, which phase is characterized by "living with
Triss [41]

Among the tasks in coping with life-threatening illness described by Kenneth Doka, the chronic phase is characterized by "living with the disease".

Kenneth Doka (1995–96) divides the process of dying into three phases, namely the acute, the chronic, and the terminal phases of dying, during which the individual initially is given the diagnosis, then lives with the disease and ultimately surrenders to death.

This phase can be quite long and the supporters may become comfortable in their caregiving role and adjust to the notion of death. This is an important adaptation since a great deal of the care for the terminally ill is given by the family members.

Doka (1998) notes that this phase "is often a period of continued stress, punctuated by points of crisis".

To learn more about Kenneth Doka here

brainly.com/question/14298713

#SPJ4

8 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • The male panda bear has 25 chromosomes in each sperm cell. How many chromosomes would be in the fertilized panda zygote?
    15·2 answers
  • (13) Can someone help me please?
    13·1 answer
  • which of the following would not be considered a point source pollution contributor a. an animal feed lot b. cattle on rangeland
    10·1 answer
  • Explain the difference between abiotic factors that may be found in a desert compared to a temperate forest
    10·1 answer
  • What is the difference between endocrine and exocrine glands?
    14·1 answer
  • How does overtillage harm soil
    5·1 answer
  • How do the offspring genetically compare to the parents?
    5·1 answer
  • What is nucler transfer used for
    6·1 answer
  • How are control and variable related
    5·1 answer
  • When a man has an erection does he releases sperm​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!