1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
german
2 years ago
5

Write two functions of kidney.​

Biology
1 answer:
exis [7]2 years ago
5 0

Answer:

remove waste products from the body. remove drugs from the body. balance the body's fluids. release hormones that regulate blood pressure.

You might be interested in
Which pattern of inheritance results from individual organisms having many different genes working at the same time to control a
saw5 [17]
The answer is polygenic inheritance.
Many physical characters (traits) depend on many different factors, each of which is determined by different genes. This is called polygenic inheritance.


For example, the color of the skin in humans. The color of the skin results from the interactions of several factors determined by different pairs of genes:-Certain genes could affect the metabolism of skin melanocytes.-Other genes can determine the distribution of melanin in the thickness of the skin.-Some genes could determine the relative amounts of each of the two possible types of melanin.-Others may affect the production of certain hormones involved in the activity of melanocytes.
8 0
3 years ago
What does sulfur dioxide and hydrogen sulfide form in the atmosphere that is bad
egoroff_w [7]

Answer:

At high temperatures or in the presence of catalysts, sulfur dioxide reacts with hydrogen sulfide to form elemental sulfur and water. This reaction is exploited in the Claus process, an important industrial method to dispose of hydrogen sulfide.

(credits to the owners of this answer :)

5 0
3 years ago
Which were expermental groups
IceJOKER [234]

Answer:

An experimental group, also known as a treatment group, receives the treatment whose effect researchers wish to study, whereas a control group does not. They should be identical in all other ways.

5 0
1 year ago
For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to
posledela

Answer:

The correct answer will be option-E

Explanation:

Hershey and Chase's experiment was performed to test whether DNA serves as the genetic material or protein.

To perform experiment they grew bacteriophage into radiolabeled phosphorus and sulfur compounds. The phosphorus is an integral part of the structure of DNA whereas proteins contain sulfur in their structure.  

In the given condition if radiolabeled nitrogen is utilized then the experiment will fail as the structure of proteins also contains an amino group( NH₂) in their structure as well as DNA. The scientist will not be able to identify whether the DNA is the genetic material or protein.

Thus, option-E is the correct answer.

7 0
2 years ago
Which of the following best describes the ploidy level of a fertilized embryo sac? A) All cells are diploid. B) All cells are tr
AveGali [126]

e. There are haploid, diploid, and triploid cells.

3 0
2 years ago
Other questions:
  • Which sequence correctly represents blood flow known as pulmonary circulation?
    9·1 answer
  • What is the unresolved problem that is facing scientists on the island of Guam?
    13·1 answer
  • Use the numbers 1,2,3, 4, and 5 to place the
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of the following is an example of the endocrine System maintaining homeostasis?
    6·2 answers
  • Please help, thank u. ​
    5·1 answer
  • Which part of my brain is probably damaged if I am unable to recognize basic objects arond my house?
    11·1 answer
  • The cell membrane is said to be semipermeable because
    11·1 answer
  • What is mauna loa volcano intensity?
    6·1 answer
  • The amount of light in the Epipelagic zone
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!