1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korolek [52]
2 years ago
5

Which of the following explains how a child might have blue eyes?

Biology
1 answer:
irinina [24]2 years ago
8 0
The answer is c: the child received genes from both of the parents
You might be interested in
A_____is a group of the same kind o living things in an ecosystem.
rewona [7]
<em>A<u> population </u>is a group of the same kind of living things in a ecosystem.</em>

<em>~I hope this helps! ;)</em>
4 0
3 years ago
Read 2 more answers
Tortoise shell cats, like the one shown above, are always femaleWhat scientific phenomenon explains the color pattern of
8_murik_8 [283]

Tortoise shell cats can be explained as the offspring from a incomplete dominance cross. Incomplete dominance gives rise to an intermediate phenotype.

The scientific phenomenon that explains the color pattern is X-linked incomplete dominance.

  • As stated earlier, the tortoise shell colour is as a result of incomplete dominance but as it exists only in females, the inheritance is X linked.
  • This means the tortoise shell colour is inherited in the heterozygous condition as females have two X (XX) and males (XY) can only be either of the parent's true breeding genotype.

Learn more about X- linked traits: brainly.com/question/14548821

4 0
2 years ago
Name of the scientist that proved all cells come from other cells.
Vladimir [108]

Answer:

Rudolf Virchow

Explanation:

He is the name of the scientist that proved all cells come from other cells.

3 0
2 years ago
What can you findout from the model of a seed
11Alexandr11 [23.1K]

Answer:

u can find out The size of the seed

7 0
1 year ago
Why are lipids and proteins free to move laterally in membranes?
Anestetic [448]
D. There are only a week Hydrophobic interactions in the interior of the membrane.
8 0
3 years ago
Other questions:
  • This term is used to describe a growth or tumor which is not dangerous because it will not grow or spread aggressively. It means
    7·2 answers
  • What would happen to the population of a animal if it food source were removed from the food chain
    11·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Any three characters of monkey​
    14·2 answers
  • I need help FAST!! U have too match the letters with the #.!
    9·1 answer
  • How does a convection current transport energy around the globe
    8·1 answer
  • all the facts and observations gathered in an experiment are called A.conclusions B.Data C.theories D.hyposthesis
    8·1 answer
  • The musculoskeletal system, a collaboration
    13·1 answer
  • Why do you think diseases vary from generation to generation?
    12·1 answer
  • 1 An elastic band can store energy.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!