1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex777 [14]
3 years ago
8

Two of the following statements are false. Circle the letter and fix the statement to make it true.

Biology
1 answer:
lys-0071 [83]3 years ago
6 0

Answer:

All options about the enzymes are true

You might be interested in
Which two major parts of the Earth system does this photo most clearly
Pachacha [2.7K]
Your answer would most likely be letter
B. Biosphere
7 0
3 years ago
Read 2 more answers
What period has the least amount of biodiversity
meriva

Answer:

Permian has the last amount of biodiversity since the period was covered with lava and ashes

8 0
3 years ago
Why do biologists have to study chemistry?
Snowcat [4.5K]
To understand the phenomenon of biological cell


To understand which principal occurs


To know the whose are reactant and what makes product



Hope for brainliest mark
5 0
3 years ago
What is the key activating signal in the TNF receptor signaling pathway that occurs downstream of TNF-alpha binding to the extra
Olenka [21]

Answer:

TNF-alpha is expressed as a homotrimer that exerts its activities through binding to two types of receptors: TNFR1 and TNFR2, which are transmembrane glycoproteins characterized by having an extracellular domain with 4 cysteine-rich domains (CRD 1-4) , each with 3 cysteinecysteine disulfide bonds.

Explanation:

TNF-alpha (Tumor Necrosis Factor), which has the characteristic of being a paracrine signaling ligand, is a pleiotropic cytokine that functions as a mediator of immune regulation, the inflammatory response and apoptosis in some cell types. Receptors in this family are involved, with some exceptions, in juxtacrine signaling; that is, both the ligand and the receptor are membrane proteins with extracellular domains through which signaling is established. The cellular responses promoted by TNF are initiated by its interaction with two different types of cell receptors, the type I receptor (55 kDa) and the type II receptor (75 kDa). Both types of receptors are part of the TNF receptor family, members of which include Fas antigen (apoptosis inducer, also called Apo-1 or CD95), CD27 (T-cell activation antigen), CD30 (lymphoma marker Hodgkin) and CD40 (B-cell antigen), which share the characteristic of cysteine-rich sequences in their extracellular domains. This family of cytokines generate cellular responses that include differentiation, proliferation, activation of NFκB and cell death, promoting the aggregation of receptor monomers, that is, they have a transmembrane domain that participates in the solubilization of the receptor and a domain of intracellular death that is involved in signal transduction. The binding of TNF to TNF-R1 induces a signaling cascade through its intracellular death domain, which subsequently leads to the activation of complex I (or inflammatory) of NFkB and proceeds to the transcription of anti-apoptotic genes, pro- inflammatory diseases and apoptosis complex II (caspases).

5 0
3 years ago
Which of these chemicals is definitely inorganic?
dexar [7]
<span>One that is made of nitrogen and hydrogen is definitely inorganic. Inorganic has these molecules in them.</span>
7 0
3 years ago
Other questions:
  • Yawning is a reflexive action that is often associated with sleepiness. when a person yawns, the mouth opens, and a longer than
    6·2 answers
  • Which is the best evidence that two species have a common ancestor?
    13·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What did the carbon dating and soil testing tell scientists about toorale man? why are the dates interesting for scientists?
    8·1 answer
  • What do you call a pig in a pawn shop?
    12·1 answer
  • Where is the urinary system in the human body
    8·1 answer
  • What structures are involved with the synthesizing and secretion?
    12·1 answer
  • 8. Compare the number of protons and electrons in a neutral atom
    5·1 answer
  • Why was the discovery of DNA important to our daily lives?
    13·1 answer
  • I need help to get the right question because i got it wrong
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!