1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LiRa [457]
3 years ago
15

I need help ASAP! You get 20 points and I will vote you brainiest!

Biology
1 answer:
serg [7]3 years ago
8 0
Answer: Rr and rr

(It won’t let me send with my explanation so I will try to put explanation in comments sorry)
You might be interested in
What is a frame shift mutation? What is the cause of this type of mutation?
astra-53 [7]
A frame shift mutation is the shift of the genetics of an object.
This type of mutation os caused by the insertion or deletion of nucleotides in a DNA sequence that is not divisible by three.
7 0
3 years ago
Planets formed from a nebular cloud of
g100num [7]

The various planets are thought to have formed from the solar nebula, the disc-shaped cloud of gas and dust left over from the Sun's formation.

8 0
3 years ago
Choose all the answers that apply.
icang [17]
The 3rd,4th, and 5th are correct.
7 0
2 years ago
Read 2 more answers
Puzzle #4 four digit code
Nana76 [90]

Answer:

Im doing this but I was honestly looking for a cheat sheet lol

3 0
3 years ago
Which level of organization is best represented by the liver?
siniylev [52]

Answer:

Organ level– an organ is a structure composed of at least two different tissue types that perform a specific function within the body. Examples include the brain, stomach, and liver. Complex functions begin to emerge at this level.

Explanation:

3 0
3 years ago
Other questions:
  • An unresponsive state from which a person can be aroused only briefly despite vigorous, repeated attempts is known as a _______.
    7·1 answer
  • A comparison of karyotypes from two carrot plants cloned from the same carrot root tissue should show that all cells of these ca
    12·1 answer
  • The data above indicate an error. How do you know? What might have caused the error​
    6·2 answers
  • Properties of metals are
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Please help be quick and correct 5
    8·1 answer
  • Need somebody to help!!!!
    10·2 answers
  • How can humans be genetically modified
    13·1 answer
  • Bonus points<br>real ans plzz help<br>or I will report you​
    7·1 answer
  • Which process begins with the replication of DNA in the nucleus of a cell?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!