1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
evablogger [386]
3 years ago
12

How does Amyotrophic lateral sclerosis disrupt homeostasis in the body? I NEED HELP pls

Biology
1 answer:
antiseptic1488 [7]3 years ago
7 0

Answer:

ALS causes the motor neurons to gradually deteriorate, and then die. Motor neurons extend from the brain to the spinal cord to muscles throughout the body.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Which of the following is TRUE about RNA and DNA?
Brrunno [24]
DNA is something everyone has in them to see
4 0
2 years ago
When the herbicide glycolaldehyde is applied to a plant, it’s cell are unable to undergo the Calvin cycle
faltersainse [42]

Answer:

Altostratus

Explanation:

4 0
3 years ago
Match the columns:
Galina-37 [17]

Answer:

I have matched them below

Explanation:

each of the columns have been properly matched below:

1. attaches bones to bones and muscles to bones = d. dense regular connective tissue

2. insulates against heat loss = a. adipose connective tissue

3. forms the fibrous joint capsule =

c. dense irregular connective tissue

4. makes up the intervertebral discs = g. fibrocartilage

5. composes basement membranes; a soft packaging tissue with a jellylike matrix = b. areolar connective tissue

6. forms the larynx, the costal cartilages of the ribs, and the embryonic skeleton = h. hyaline cartilage

7. provides a flexible framework for the external ear = e. elastic cartilage

8. provides levers for muscles to act on = i. osseous tissue

9. forms the walls of large arteries = elastic connective tissue

6 0
3 years ago
A typical cell in an animal's body is considered
bekas [8.4K]

The correct Answer is diploid, i just took the test..................

7 0
3 years ago
Other questions:
  • Living thing composed of more than one cell
    10·2 answers
  • A scientist makes an image of all of a person's chromosomes. What technique is she using?
    14·2 answers
  • Which process is responsible for the growth and repair of human tissue
    7·1 answer
  • DNA replication or repair occurs in a cell in all of the following situations, EXCEPT when
    11·2 answers
  • What is one of the functions controlled by the cerebellum?
    14·2 answers
  • Comparing sequences between genes and between species allows evaluation of the rates of change. Which of the following have been
    7·2 answers
  • Whyshould humans save endangered animals from extinction?
    12·2 answers
  • Algae can grow out of control when too many nutrients containing ______ and _______ enter the water.
    11·2 answers
  • What do sensory neurons do with the information from the receptors ?
    11·1 answer
  • If inhibiting thyroid hormone release with PTU (propylthiouracil) in an experiment, the ____ group receives PTU and the ____ gro
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!