1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
3 years ago
8

What two numbers have a difference of 8?

Mathematics
2 answers:
Kaylis [27]3 years ago
8 0

Answer:

12 and 4

Step-by-step explanation:

hope this helps you lovely!

ivann1987 [24]3 years ago
3 0

Answer:

12 and 4

Step-by-step explanation:

You might be interested in
The table shows the cost of posting parcels.
alexandr402 [8]

Jake wants to post a 600 gram parcel and an 800 gram parcel.

He posts them Second Class.

He pays with a £10 note.

How much change should he get?

3 0
2 years ago
Which pair of numbers are not opposites?
Vinvika [58]
A
The absolute value of -27 is 27, so it is the same number
7 0
3 years ago
Read 2 more answers
Find the area of the composite area
QveST [7]
Area of rectangle = LxW = 13x7 = 91

Area of triangle = bxh/2 = 7x7/2= 24.5

Total area= 91+24.5= 115.5 in^2
8 0
2 years ago
What is the slope of the equation Y=5/4x-7/4?
maksim [4K]

Answer:

Step-by-step explanation:

Compare the equation with y = mx + b where m is slope and b is y intercept

y = (5/4)x - (7/4)

Slope = m = 5/4

4 0
2 years ago
Suppose that the functions s and t are defined for all real numbers x as follows.
PolarNik [594]

Answer:

(s-t)(-1) = -1

(s+t)(-1) = -7

Step-by-step explanation:

Given the following set of functions

s(x)=2x-2

t(x)=3x

(s-t)(x) = s(t) - t(x)

(s-t)(x) = 2x - 2 - 3x

(s-t)(x)  = -x -2

(s-t)(-1) = -(-1) - 2

(s-t)(-1) = 1-2

(s-t)(-1) = -1

(s+t)(x) = s(t) + t(x)

(s+t)(x) = 2x - 2 + 3x

(s+t)(x)  = 5x -2

(s+t)(-1) = 5(-1) - 2

(s+t)(-1) = -5-2

(s+t)(-1) = -7

8 0
3 years ago
Other questions:
  • In a randomly generated list of numbers from 0 to 6, what is the chance that each number will occur?
    6·2 answers
  • P=2a+2b , solve for b
    6·1 answer
  • Ive never been good with these kind of questions
    10·1 answer
  • Something about an organism that allows it to live and reproduce effectively in its
    6·2 answers
  • Another home business has an average income of $1.200.00 per month with a standard deviation of $100.00. If the income in a give
    15·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • I’m stuck on this I’ll give u brainlieast if you answer correctly !
    7·1 answer
  • Answer the following questions CORRECTLY I will know if this is wrong. I WILL REPORT ANY INCORRECT ANSWERS!
    8·2 answers
  • Given the equation of a line y =-5x -16, what is the slope of a line PARALLEL to this line? ​
    9·1 answer
  • Write a four digit whole number that is divisible by 2. Use a divisibility rule and explain how you know that your number is div
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!