1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wittaler [7]
3 years ago
8

The skin separates the human body from the environment. Skin structure serves which primary function?

Biology
1 answer:
Vikentia [17]3 years ago
8 0
It prevents micro bacteria from entering our body, so it would be A.) Preventing infection
You might be interested in
If you were studying the causes of cancer, which topic might interest you?
nikdorinn [45]

spindle-fiber structure because this is used to divide cells; cancer is just cells dividing way too much. so if the <em>spindle-fiber structure </em>were to fail it could cause cancer.

5 0
4 years ago
Read 2 more answers
Apicomplexans evolved from a photosynthetic ancestor and have the remnant of a chloroplast. This organelle no longer acts in pho
atroni [7]

Answer:

Apicomplexans can be described as parasites which can cause diseases such as malaria inside the host cell. These organisms are known to evolve from the green algae. The remnant chloroplast present in them is used for various drug therapy studies. Their chloroplast can be used to test for various antibiotics and herbicides. This is because their chloroplast has evolutionary similarities with chloroplasts present in other organisms such as the cyanobacteria.

4 0
4 years ago
A spacecraft orbits 327 kilometers above the surface of Earth. Assume that the spacecraft passes over Earth's North and South Po
Ierofanga [76]
I dont have a calculator on hand but what you gotta do is add those two numbers up, making 13,077, then add an extra 327 to get the full d of earth then multiply that by pi to get the circumference of earth and you got the orbit
7 0
3 years ago
Texting about routine or mundane topics can help build relational intimacy in dating couples.
kompoz [17]

Given what we know, we can confirm that text about routine or mundane topics does in fact help build relational intimacy in dating couples.

<h3>What is relational intimacy?</h3>
  • This is an emotional form of intimacy.
  • It involves proper communication and trust.
  • It entails the trust to be transparent with one another, which includes sharing secrets and details about one's life.

Therefore, we can confirm that texting about routine or mundane topics can help build relational intimacy in dating couples, given that they will be more likely to share secrets with one another and have healthy communication.

To learn more about intimacy visit:
brainly.com/question/25664183?referrer=searchResults

8 0
3 years ago
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
Fittoniya [83]
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
8 0
4 years ago
Other questions:
  • ASAP
    6·1 answer
  • Which natural resource does Australia produce more of than any other country in the world? oil natural gas gold bauxite
    5·2 answers
  • Science-
    6·1 answer
  • Some infants cannot synthesize several of the traditionally nonessential amino acids. These amino acids must be obtained from th
    8·1 answer
  • Is a membrane a cell organelle
    13·1 answer
  • Which muscles is involved in normal quiet inspiration?
    10·1 answer
  • TRUE OR FALSE: CYANOBACTERIA IS A GROUP OF BACTERIA THAT USED TO BE CLASSIFIED AS ALGAE
    15·2 answers
  • What is the gravitational force of attraction that exists between two spheres if mass 2. 0 kg each separated 2. 0 m from center
    7·1 answer
  • Which statement accurately describes the variables in this study?
    11·1 answer
  • What can you do with dna after you take it out of an organism.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!