1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veronika [31]
3 years ago
8

ALGAE --> COPEPODS --> ANCHOVIES --> STRIPED BASS

Biology
1 answer:
Valentin [98]3 years ago
3 0

Answer:

B

Explanation:

only plants convert solar energy to chemical energy.

You might be interested in
1. A student is completing a Punnett square for a trait (X/x) that is autosomal and inherited by the dominant allele. The father
zvonat [6]

Answer:

C

Explanation:

autsomsal means that it is not x-linked/ realted to gametes. Dominate means that it needs only one X to get the trait

Using the punnet square

             X       x

      x     Xx   xx

      x     Xx   xx

there is 2 X which means there is a 50% change that their child will get the trait

5 0
2 years ago
Distilled water has a pH of 7. Milk has a pH of 6. Therefore, milk is: A. 10 times less acidic than distilled water. B. half as
lina2011 [118]

Answer:

(C) 10 times more acidic than distilled water.

Explanation:

The pH scale is logarithmic, meaning a pH difference of one is a difference of 10 times.

8 0
2 years ago
Which water-soluble vitamin plays an important role in the formation of collagen?
makvit [3.9K]

the correct answer is

a. vitamin c


8 0
2 years ago
Read 2 more answers
The amount of air in the lungs after a normal exhale is called the ______________ .
il63 [147K]

Answer:

Expiratory reserve volume

8 0
2 years ago
Compare and contrast the causes and process of primary and secondary succession.
liberstina [14]

Answer:Primary succession occurs on land that is new and has never had a flora and fauna example: glacier retreats, lava flows. Secondary succession occurs on land that has been cleared example: by fire, of flora and fauna, but which still has viable seeds and spores in the soil.

7 0
2 years ago
Other questions:
  • What happens when sunlight Strikes chlorophyll?
    14·1 answer
  • In comparing photosynthesis and cellular respiration, which of the following is TRUE?
    8·2 answers
  • Which substance is a binary acid? hydrochloric acid phosphoric acid nitrous acid sulfuric acid
    13·2 answers
  • Checking for contents of the intestinal tract would be done during which phase of the autopsy?
    9·2 answers
  • The development of the cell theory involved ___________________________. A. different ideas from different scientists. B. the ef
    14·1 answer
  • A genomic sequencing method called _______ sequencing was used in the human genome project. In this method, DNA is broken into m
    12·1 answer
  • Sets the metabolic rate for the cells of the body describes
    12·1 answer
  • Genetics: A geneticist is studying two genes. Each gene can be either dominant or recessive. A sample of individuals is categori
    11·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Somebody help me so I can give y’all some points
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!