1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
never [62]
3 years ago
13

Which of the following is NOT a nucleic acid ?

Biology
2 answers:
Sergeeva-Olga [200]3 years ago
6 0

Answer:

DNA

Explanation:

34kurt3 years ago
3 0

Answer:

reverse transcriptase

Explanation:

You might be interested in
A solution of an enzyme and a substrate was placed in a water bath and the temperature of the reaction was raised gradually. Wha
mario62 [17]

Answer:

When a substrate is added in water, the enzyme will cause the substrate to dissolve in water. Increase in temperature will cause better functioning of the enzyme and more solute to be dissolved until an optimum temperature. Optimum temperature can be described as the temperature at which the activity of the enzyme is highest.

After optimum temperature is reached, the enzyme will get denatured and the substrate will no longer be able to dissolve in water.

8 0
3 years ago
Photosynthesis vs cellular respiration
Lostsunrise [7]

Answer:

I don't really know

Explanation:

sorry bud can't figure it out

5 0
3 years ago
Read 2 more answers
In humans, the yolk sac ________. in humans, the yolk sac ________. is the site of origin for blood cells and primordial germ ce
aleksklad [387]

In humans, the yolk sac is the site of origin for blood cells and primordial germ cells. The human yolk sac is a membrane located outside the embryo and it is connected by a tube through the umbilical opening to the embryo's midgut. The yolk sac serves as an early site for the formation of blood and in time, is incorporated into the primitive gut of the embryo.






8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Jim makes an electromagnet by wrapping a copper wire around a nail and then connecting it to a battery. If he brings the end of
Rufina [12.5K]
The following of what? It sounds like there is more than one answer. 
5 0
3 years ago
Read 2 more answers
Other questions:
  • In a survey, a group of students were asked their favorite sport. Eighteen students chose “other” sports.
    6·2 answers
  • Which is the first step to occur during the process of replication?
    13·1 answer
  • What refers to the number of particles of a substance per unit of volume?
    11·1 answer
  • What do we call the process by which harmful toxins become more and more concentrated in organisms in a food chain
    13·1 answer
  • Explain why there is no beginning or end to the rock cycle.
    5·1 answer
  • What is the specific energy an electron in an atom or other system can have?
    7·1 answer
  • The chart shows parts of the body at different levels of organization.
    13·1 answer
  • Plz anybody help me out :)
    14·1 answer
  • Why do animals need to take in oxygen?
    15·1 answer
  • Which is NOT a result of artificial selection?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!