1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sloan [31]
2 years ago
14

Compare and contrast the advantages and disadvantages of selective breeding versus genetic modification. Why might a person choo

se to use selective breeding over genetic modification? Why might a person choose to create a GMO over a selectively bred organism? Use three to five sentences to formulate your argument. 100 POINTSSS
Biology
2 answers:
maw [93]2 years ago
7 0

Answer:

Here are just some facts that you can put into paragraph form:

<u>Pros of GMO:</u>

They are "perfect" in theory

Most likely won't have any diseases or infections

Genetically modified so everything will be <em>almost</em> <em>exactly</em> the way people want it to be

<u>Pros of Breeding:</u>

Definitely more organic and healthy (i guess)

More authentic - they're the "real stuff"

People might feel safer when eating organic stuff

Explanation:

<em>I rlly hope this helps :)</em>

mixas84 [53]2 years ago
7 0

Answer:

Explanation:

The other helper already provides a lot of info on the two different methods. I will add that a person might choose to use selective breeding over genetic modification because it does not require any advance technology or sophisticated laboratory.  On the other hand a person might choose to create a GMO over a selectively bred organism because it will take less time to get results.

You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
Which of the following processes take place in the cell nucleus?
Aleksandr-060686 [28]

Answer:

A i believe

Explanation:

5 0
3 years ago
Read 2 more answers
What two human systems deal with allergies?
Effectus [21]

One is immune system. ‍‍‍‍

5 0
3 years ago
I need help with this it’s due at 12:00 PM
yKpoI14uk [10]
The satellite that orbit earth without gravity would collide into earth since there is no gravity to hold it up there in space.
7 0
2 years ago
Unicellular organisms excrete waste by _____.
telo118 [61]
Unicellular organisms excrete waste by a contractile vacuole. A vacuole is membrane-enveloped organelle in a cell that is found in lots of microorganism. It expands, filling with water then contracts, removing all of its contents to the exterior of the cell.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Why do you think people believe some theories even if they´re not supported by scientific evidence?
    6·1 answer
  • 8. Gestation period of cow is days,<br>(A) 283 - 285 (B) 290 - 292<br>(C) 142 - 145 (D) 152 - 154​
    14·2 answers
  • Which of the following statements is TRUE?
    12·1 answer
  • 11. Diabetics are often required to monitor their blood glucose levels to determine
    12·1 answer
  • I NEED HELP QUICK Why can we see Codominance more in flowers that in people?
    5·1 answer
  • Porqué se encuentran fósiles marinos en las montañas mas altas de la Tierra?
    15·1 answer
  • Can you please help me?
    11·1 answer
  • Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainliest Brainli
    6·2 answers
  • Could you locate a central of expansion
    15·1 answer
  • 1. What are the three main parts of the cell cycle:
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!