1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
2 years ago
13

Pls help I’m almost done with my quiz

Biology
1 answer:
Hunter-Best [27]2 years ago
4 0

Answer:

The last one

Explanation:

You might be interested in
Is it true that bedrock can eventually become soil sediment?
gulaghasi [49]
Yes it is true because after many years of water or wind eroding away at the rock will cause it to break up into tiny pieces
7 0
3 years ago
Alga mikroskopik<br>bersaiz<br>...<br>..​
sveticcg [70]

Answer:

Mikroalga adalah alga mikroskopik, biasanya terdapat di sistem air tawar dan laut. Mereka adalah spesies uniselular yang wujud secara individu, atau dalam rantai atau kumpulan. Bergantung pada spesies, ukurannya boleh berkisar antara beberapa mikrometer (µm) hingga beberapa ratus mikrometer.

Explanation:

6 0
2 years ago
Which molecule forms the bulk of a cell membrane? a phospholipid b glucose c dna d protein submit answer?
Gala2k [10]
Phospholipids are main in membrane
5 0
3 years ago
Which of the following are permanently protected lands which contain endangered or threatened species?
Zinaida [17]

Answer:

Endangered speciees mitigation

Explanation:

I thinl it is

7 0
3 years ago
Read 2 more answers
A student measures the air pressure inside her bicycle tires before and after she goes on
jeka57 [31]

Answer:

Explanation:

123

4 0
3 years ago
Other questions:
  • 1) the beauru of land management manages over ___ acres of land in the united states.
    14·2 answers
  • This student is holding a model of the human brain.
    7·1 answer
  • What does the term nucleosynthesis refer to?
    13·1 answer
  • ¿Por qué habría un problema taxonómico como resultado del descubrimiento de Ostrom?
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which values are equivalent to the fraction below?
    15·1 answer
  • Why do many diseases such as measles occur only once in a person yet others such as colds occur more than once?
    8·1 answer
  • What will a cold air mass do when it moves into a warm air mass
    6·1 answer
  • Rock and Water grind against each other?
    7·1 answer
  • Which type: of mutation occurs when two non-homologous chromosomes exchange genetic material?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!