1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ira [324]
3 years ago
9

Adaptations are important for the survival of both animals and plants. A plant such as the cactus has many adaptations that help

it survive in its environment. A cactus' roots are long, but close to the surface of the ground, and they cover a large area.
What is the possible advantage that this root system offers the cactus?
A.
It makes the cactus look pretty.
B.
It doesn't help the cactus at all.
C.
It makes getting water easier and quicker for the cactus.
D.
It makes getting water harder and slower for the cactus.
Biology
2 answers:
posledela3 years ago
6 0

I think c (it makes getting water easier and and quicker for the cactus

m_a_m_a [10]3 years ago
6 0

Answer:

C. It makes getting water easier and quicker for the cactus.

Explanation:

Cacti have roots that are perfectly adapted to the dry and hot climate of a desert. Some of them are very long to reach the water underground, providing them enough water. Some have roots that are very extensive and shallow, this is because they have a different strategy, they take their water mostly from brief showers, and their roots allow them to maximize the amount of water they can get.  A corky layer on the roots also helps to prevent water loss.

You might be interested in
Which layer of gas molecules in the atmosphere is bombarded with rays from the sun?
miv72 [106K]
The answer is : Thermosphere. At this point the homosphere (troposphere, stratosphere and mesosphere) ends at about 80 km from the surface, gas molecules<span> are here</span>bombarded<span> by X-</span>rays from the sun<span> and subsequently form the ionosphere.

Hope this helps! :)</span>
5 0
3 years ago
How does the domain Eukarya differ from the other two domains? A) All organisms in the domain are heterotrophic. B) All organism
Katarina [22]

c is ur answer pls mark brainliest

7 0
3 years ago
Read 2 more answers
Respiratory function deteriorates as a result of pneumonia because inflammationA) causes fluids to leak into the alveoli.B) caus
xenn [34]

The correct answer is: D) A and B only

Pneumonia is an inflammatory condition of the lungs that is usually caused by infection with viruses or bacteria. Pneumonia causes the fluid fill of the alveoli (air sacs). As a result symptoms such as cough with phlegm or pus, fever, chills, and difficulty breathing might occur. Pneumonia can be serious condition, especially for infants and people with weakened immune systems.

3 0
3 years ago
Read 2 more answers
After the first day or so of fasting, most of the body's stores of __________ are depleted.
liubo4ka [24]
After the first day or so of fasting, most of the body's stores of <span>glycogen </span><span>are depleted.
</span>
7 0
3 years ago
Read 2 more answers
What organelle is Excretory please help ASAP only if you know the answer
GenaCL600 [577]

Answer:

Vacuole

Explanation:

Good for you, I just got done with the cell in science so congrats!

;)

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is used up during cellular respiration
    15·1 answer
  • Biology Assignment
    7·2 answers
  • Which term means the level of effort required to complete an activity? a.recovery b.intensity c.time d.variation
    5·2 answers
  • Disease can affect a species by
    8·1 answer
  • Another term for the lateral recumbent position​ is:
    15·1 answer
  • Why genes close together in the same chromosome are said to be linked
    14·1 answer
  • Explain how Ice cream ultimately comes from plants
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is the main substrate in the first step of glycolysis?
    14·1 answer
  • Part C: Simulate Reforestation
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!