1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paul [167]
3 years ago
12

What 2 vocabulary words depend on each other, or "go hand in hand"?

Biology
2 answers:
disa [49]3 years ago
8 0

Answer:

C. Structure and Function

Explanation:

The reason as to why it is C is because, Structure means construct or arrange according to a plan; give a pattern or organization to, to put it more simple, the way something is built to help the way it functions. So for example, the structure of a hair brush is built to pull out the tangles, why would I use it on feet? It's not structured the way it will help function my feet. Function means, work or operate in a proper or particular way. Example: "bridges perform the function of providing access across water" Basketball shoes are "STRUCTURED" in a way it'll help the basketball player play better. You wouldn't wear boots to a basketball game because boots are structured in order to help the human feet get through the snow. Basketball shoes are structured in order to help it function so that the basketball player can move around freely on the court and play freely.

astra-53 [7]3 years ago
6 0
C hope this help enjoy ya day
You might be interested in
Choose the appropriate term to fill in the sentence: when mrs. m ate, her intestinal contents became __________ to her blood. he
KonstantinChe [14]
<span>The answer to this question would be: hypertonic, hypotonic

After eating, the intestine is filled with food that will be digested. Food that digested will turn into a much smaller unit of carbohydrate, amino acid and fatty acid that will cause the intestine to have hypertonic solution compared to the blood. This will induce diffusion of some molecule to the intestinal cell, and then to the blood.</span>
3 0
4 years ago
Which of the following terms are needed to completely describe velocity
Ede4ka [16]
C. Direction

Hope this help.
6 0
3 years ago
Read 2 more answers
Choose the incorrect statement from the following sentences. i.Chlorenchyma is specialized parenchyma that has chlorophyll pigme
Marta_Voda [28]

the third statement is wrong. Parenchymal cells have thin walls and the nuclei are not visible.

7 0
4 years ago
Read 2 more answers
Cell membranes are made up of a phospholipid bilayer. Which part of the phospholipid bilayer interacts with water, and which par
ki77a [65]
The part of the phospholipid bilayer that interacts with water would be the hydrophilic portion consisting of the polar phosphate group. The hydrophobic tails which are the fatty acid chains will not interact with the water present in the aqueous environment.
5 0
3 years ago
Read 2 more answers
Why will salivary amylase NOT break down proteins?
lina2011 [118]
Because salivary amylase is an enzyme that produce by salivary and to break down starch. And starch is a kind of polysaccharide. It is consists of monosaccharide while protein is consists of amino acids. They are different things.
6 0
3 years ago
Other questions:
  • ¿Qué pasaría si no tuvieras un sistema excretor?
    15·1 answer
  • Which of the following sources is likely to provide the most reliable scientific
    13·2 answers
  • Hershey and chase used a dna-based virus for their work. what would the results have been if they had used an rna virus?
    15·1 answer
  • The immediate source of energy that powers a cell’s activities is
    14·2 answers
  • What name refers to the sum of all chemical reactions in an organism?
    12·1 answer
  • In humans, different cell types, such as smooth muscle cells, have specific structures and roles that they play in the body. Mos
    8·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • a scientist isolates a number of non photosynthetic prokaryotes which structure would be found in theses cells​
    13·1 answer
  • Who are the consumers of the organism represented by the blue arrow?
    12·1 answer
  • Photosynthesis takes place in the?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!