1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Likurg_2 [28]
3 years ago
8

Where does black line appear?

Biology
2 answers:
earnstyle [38]3 years ago
8 0
I don't think I can answer that cuz' I do not know what black line you're talking about

ddd [48]3 years ago
6 0
If you are asking about pregnancy, then in that case, this is also called Linea Nigra. One of the most common sign of pregnancy. It runs up the abdomen between the pubic area and bellybutton, or even higher. It is usually about .25-.5 inch wide, growing darker as the pregnancy advances. 

You might be interested in
What are the major types of nutrients you can get from food ​
Hatshy [7]

Answer: lipids, proteins, carbohydrates, and water

Explanation:

These are the four major nutrients that you can get from food. Hope this helps!

7 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What type of protein penetrates to the interior of the plasma membrane but does not extend all the way through it?
stellarik [79]
Integral Hope this helps ;)
4 0
3 years ago
If a blood cell is placed into a solution of 10M salt (highly salty) what would you expect to occur?
steposvetlana [31]
The blood cell will lose water and will undergo lysis.

Cell membrane is permeable to water and can get/lose water via osmosis. Osmosis is induced by the gradient of concentration of the solution. In this case, the 10M salt solution has a very high oncotic pressure that it will attract nearby water. That means the water inside the cells will be taken into the solution and cell will continue to shrink and then die.
6 0
4 years ago
Would someone Please answer this question please will be thanked and also will pick brainly!! (please be honest)
jek_recluse [69]
Hey! they are usually single celled!
hope this helped xoxo
6 0
3 years ago
Read 2 more answers
Other questions:
  • Delia has a genetic disease that causes her to be weak and tired because her blood cells are not able to carry enough oxygen to
    14·2 answers
  • Use the terms phenotype and genotype in a <br> complete sentence.
    9·2 answers
  • Determine whether each characteristic is exhibited by plants or fungi.
    6·2 answers
  • Which of the following is not a possible cause of mass extinction?
    9·2 answers
  • Why properties of a substance determine how that substance is will react when combined with other substance
    10·2 answers
  • What are the requirements of light-independent reactions? Where do light-independent reactions occur?
    8·2 answers
  • What is the major cavity for brain
    7·1 answer
  • What happens to biodiversity<br> and ecosystems when the<br> environment changes?
    7·1 answer
  • A mutation occurs that leads to
    6·1 answer
  • What are the nutrients and minerals necessary for plants to go grow and what are their functions?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!