1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marin [14]
3 years ago
15

MRNA vaccines are DIFFERENT from other vaccines in they: (Choose all that are different from other vaccines only)

Biology
1 answer:
Advocard [28]3 years ago
6 0

Answer:

A truly du/\/\b question

that said I would say E only

Explanation:

You might be interested in
This developing plant uses starch stored in the seed as a source of energy during germination. This stored starch is a by-produc
Nata [24]
The answer is C. Photosynthesis. 

I hope this helps. 

Have a nice day. :) 
5 0
3 years ago
Read 2 more answers
A series of two-point crosses among fruit flies is carried out between genes for brown eyes (bw), arc wings (a), vestigial wings
Stels [109]

Answer:

E) bw 5 a 24 cv 13 vg with e assorting independently

Explanation:

Due to technical problems, you will find the complete explanation in the attached files  

Download pdf
8 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
How do individuals contribute to the flow of economic activity
rewona [7]

Every person has their own part to play or if you want to get scientific then a niche. And if somebody doesn't do their job then it could slow everyone else down. Maybe I don't fully understand the question, But I hope its right.

8 0
3 years ago
What part of the reproductive system is highlighted below?
adell [148]

Answer:

A. Urethra

Explanation:

The part highlighted below is also known as the Urethra, or the tube in which the urine or semen travels in the male reproductive system! :)

8 0
2 years ago
Other questions:
  • The action that moves the scapula towards the head is called __________. the action that moves the scapula towards the head is c
    12·1 answer
  • Why do our cells need to transfer ATP into energy?
    13·1 answer
  • What is The uncondensed dna present in the nucleus
    12·1 answer
  • How do humans shield plants and animals from natural selection? How do you think human can cause the genes for desirable charact
    13·1 answer
  • Why are there three different wind patterns in each hemisphere
    8·1 answer
  • What are the names of the 3 major pairs of salivary glands?
    13·1 answer
  • How can a change in the density of a gas affect the temperature of a gas?
    5·2 answers
  • Reaaallly need help!!​
    15·1 answer
  • What is a situation where your sympathetic nervous system would be active? Give me an example from real life.
    8·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!