1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tcecarenko [31]
3 years ago
5

Describe 2 homologies (structures that were shared from a common ancestor) between the Zeuglodon and the Orca.

Biology
1 answer:
Elden [556K]3 years ago
5 0

Answer:

Homologous structures can be described structures which originate in different organisms from a common ancestor and may or may not have the same functions.

Zeuglodons can be described as ancient whales and Orca is a common whale today known as the killer whale.

<u><em>Scientific studies show that Zeuglodans and Orca have many structures in common such as:</em></u>

  • <u><em>Having teeth with two roots</em></u>
  • <u><em>The presence of nostrils</em></u>
  • <u><em>Pelvis and internal femur bones</em></u>

You might be interested in
Number the phases of the moon in the order that they occur, beginning with the new moon as number 1.
Sphinxa [80]

Answer: The moon phases  in order:

New moon.

Waxing Crescent.

First Quarter.

Waxing Gibbous.

Full moon.

Waning Gibbous.

Third Quarter.

Waning Crescent.

Explanation:

5 0
3 years ago
List the levels of organization from smallest to largest and give an example for each. cell….
Olin [163]
From smallest to largest. That will be
Cell; cheek cell
Tissue; hydra
Organ; heart
System; digestive system
Organism; lion
Tissue is a group of cells, an organ is a group of tissues, a system is a group of organs, an organism is a group of systems
Hope that helped. Have a nice day
5 0
3 years ago
A client has undergone a transverse rectus abdominis myocutaneous (TRAM) flap procedure for breast reconstruction immediately fo
noname [10]

Answer:

breathing and leg exercises

Explanation:

Based on the information provided within the question it can be said that the most appropriate to include in the client's postoperative plan of care would be to make sure complete their deep breathing and leg exercises. This is because after these surgeries the individual will be on bed rest, thus limiting their activity and putting them at risk for respiratory problems as well as deep vein thrombosis. Therefore doing these exercises will help prevent these complications.

8 0
3 years ago
The key ingredient of an arterial fluid classified as a cosmetic fluid is a(an)?
lesya692 [45]
I believe it’s an active dye?
4 0
3 years ago
Most countries have outlawed whaling, but some countries have few or no laws protecting whales. Why are conservation groups push
Gala2k [10]

The answer is D unrestricted whaling could lead to their extinction.


4 0
3 years ago
Read 2 more answers
Other questions:
  • Is it a?
    5·1 answer
  • Mineral deposits in streams may be extracted by which method?
    10·2 answers
  • Which of these is a body fossil a. dinosaur nest b.shrimp burrow c. leaf imprint d. claw print
    13·2 answers
  • 50 points!! please help rewrite this in your own words thank you!!
    10·2 answers
  • Which statement about enzymes is true?
    9·1 answer
  • Which of the following is a solution?
    10·2 answers
  • Identify the characteristic or function all roots have in common.
    14·1 answer
  • HELP PLEASE!!! TEST IS DUE!!
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • After a scientist finishes conducting an investigation, he or she is expected to publicly present the results. Why is it importa
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!