1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luda [366]
4 years ago
14

Humans are vulnerable to the forces of nature. Which description is an example of a conflict and resolution that best supports t

his theme? Ginger and Steve were walking in the park when it started drizzling snow. They decided to call it a night. Ginger and Steve fell in love when they met while camping in Alaska. Unfortunately, Ginger lived in a different country, so they decided not to date. Steve wanted to ask Ginger to marry him, but before he could, Ginger asked Rick to marry her. Steve realized that he and Ginger would never be together. Ginger and Steve got lost while camping in Alaska. Although Ginger survived, Steve was killed by the extreme cold.
Biology
2 answers:
nataly862011 [7]4 years ago
8 0

answer is D. I am taking the pre topic test right now actually.

just olya [345]4 years ago
7 0
<span>Ginger and Steve got lost while camping in Alaska. Although Ginger survived, Steve was killed by the extreme cold. </span>
You might be interested in
What is the name given to cell division in eukaryotes
Nimfa-mama [501]
There are two kinds of cell division in Eukaryotes:  Mitosis where both cells are identical and Meiosis where the child cell has less chromosomes than the parent.
3 0
3 years ago
Read 2 more answers
I need help in #63,64,65,66,67
Mila [183]
63, C
64 a
65 C
My guess GOODLuck buddy
3 0
3 years ago
Circle the letters that identify a type of rock
maria [59]
The answers are a, igneous, and b, sedimentary. Hope this helped!
8 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Which of these is a function of the cell membrane in all cells?
Ivenika [448]

Answer:

c

Explanation:

7 0
3 years ago
Other questions:
  • Compare and contrast a few aspects of animal and plant cells. You can focus on intra- and extracellular structures they share or
    13·1 answer
  • Vaccines, antitoxins, and other drugs are distributed by the:
    8·2 answers
  • Difference between aerobe and anaerobe?<br> Simple quick definitions real quick! Will upvote! &lt;3
    6·1 answer
  • True or false: the earths mantle lies directly below the inner core
    5·2 answers
  • Name a living creature without an evolutionary history
    15·1 answer
  • Which way does a pyroclastic flow move from a volcano?
    14·2 answers
  • How many chromosomes do most human cells contain?
    14·2 answers
  • Name two substances<br>that are made when glucose reacts with oxygen inside a cells​​​​​​​​​​​​
    13·2 answers
  • Using the ecosystem model above, develop a constructed
    6·1 answer
  • Mucus that protects your stomach lining is secreted by which type of epithelial cell?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!