1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paha777 [63]
3 years ago
6

name two medical technologies that have helped combat the spread of disease in cities. Explain how each technology has helped

Biology
2 answers:
Brrunno [24]3 years ago
7 0

Answer:

Masks and Vaccines (RNA vaccines but normal vaccines help as well)

Explanation:

ivanzaharov [21]3 years ago
3 0

Answer:

Masks and Vaccines (RNA vaccines but normal vaccines help as well)

Explanation:

Masks: As we can tell cities that have a mask mandate have lower corona numbers

Vaccines: Vaccines give your body the antibodies that it needs to protect your body from infection without the virus. RNA vaccines are better than the normal vaccines because they are going to be produced faster than normal vaccines

You might be interested in
What are the thin fibers that send messages between the brain and different parts of the body?
a_sh-v [17]
Dendrites branch from the body and axons send the message
7 0
3 years ago
Read 2 more answers
O come up with a logical alternative for an unresolved problem, scientific data and research are not considered relevant.
iris [78.8K]
The answer would be False.
7 0
3 years ago
Read 2 more answers
To carry out their life processes, people need _____.
Bingel [31]
The answer is Energy
5 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Which statement best describes long-term environmental changes?
Vikki [24]

D for sure. Just like how the ground rises over millions of years.

8 0
3 years ago
Read 2 more answers
Other questions:
  • What can you learn from your models that you cannot by looking at structural formulas
    13·2 answers
  • The circulation of water in the ocean due to differences in density between the different layers of water is most likely respons
    13·1 answer
  • You should dedicate _______ of your dinner plate to protein-rich foods.
    7·2 answers
  • "A young pregnant woman went to a childbirth class and the instructor informed them about strengthening the muscles of the pelvi
    12·1 answer
  • Through which vascular tissue does water and nutrients get transported to reach the leaves during transpiration?
    5·2 answers
  • Walter Sutton investigated the number of -------- in grasshoppers.
    8·1 answer
  • Which of the following uses CO2 fr carbon and H2 for energy?
    8·1 answer
  • The attatched image has the questions, Zoom in to read if necessary.
    11·1 answer
  • What is the main function of the immune (lymphatic) system?
    5·2 answers
  • PLEASE solve number 1 and 2 because i don’t get it , don’t mind my answers
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!