1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
topjm [15]
3 years ago
13

The humerus is the long bone that extends from the shoulder to the elbow. Which skeletal system does the humerus belong to?

Biology
2 answers:
Anna71 [15]3 years ago
3 0
appendicular skeleton (The Humerus)<span>Is the composition of upper and lower limb bones.</span>
Leno4ka [110]3 years ago
3 0

on my test its D which is appendicular skeleton

You might be interested in
Human females produce gamete cells that have what chromosomes
Wewaii [24]
<span> Human females produce gamete cells that each have one X chromosomes. </span>
6 0
3 years ago
The respiratory system branches like the circulatory. Oxygen and carbon dioxide diffuse between the end of these branches and th
Feliz [49]

Answer:

1. Ends of the respiratory branches are called alveoli.

2. C. To control blood flow to different areas of the body depending on activities

Explanation:

1. The trachea divides into left and right primary bronchi which in turn divide multiple times upon entering the lungs and make the bronchial tree.

The final branches of the bronchial tree are the terminal bronchioles that lead to alveoli. The alveoli are the balloon-shaped structures and serve as the site of gas exchange between the blood and inhaled air.  

2. The opening and closing of sphincters of capillary beds regulate the direction of blood flow. The opening of sphincters allows the blood to flow into associated branches of capillary beds while closed sphincters direct the blood from arterioles to venules via thoroughfare channel.

This local change in blood flow is responsible for the autoregulation of blood flow to different tissues to match their respective metabolic demands. For example, during physical activity, more blood is directed to skeletal and cardiac muscles.

8 0
3 years ago
Según la historia evolutiva y sus diferentes saltos, ¿Qué linaje de especies es más antiguo?
Arturiano [62]

es la A

Hace aproximadamente 250 millones de años ocurrió la extinción masiva del Pérmico-Triásico, un evento en el cual murieron hasta el 96 por ciento de las especies marinas y un porcentaje similar de las terrestres. Cerca de tres millones de años después se produjo la separación, a partir de un ancestro en común, de los linajes que con el tiempo darían origen a las aves y los cocodrilos. El grupo que incluye tanto a cocodrilos como aves se lo denomina Archosauria, que significa ‘reptiles dominantes’.

espero y te ayude

6 0
3 years ago
1. What processes that occur during meiosis contribute to
andrey2020 [161]
A and D because cytokinesis is where a single eukaryotic cell divides into two daughter cells. Gametogenesis is the name given to the process where the cell undergoes meiosis.
8 0
2 years ago
What are some Major Characteristics Temperate Deciduous Forest
kramer

Answer:

The Temperate Deciduous Forest is a biome that is always changing. It has four seasons: winter, spring, summer, and fall. Constant rainfall and daylight saving hours also contribute.

Explanation:

Temperate deciduous forests get between 30 and 60 inches of precipitation a year, this helps keep the forest lush and green. When it comes to daylight savings in the fall, lack of sunlight can affect photosynthesis and the amount of sun the plant gets. Unlike the amazon forest, the temperate biome goes through all 4 seasons and has plant regeneration in the spring instead of constant vegitation.

Hope this helps :)

7 0
3 years ago
Other questions:
  • List some reasons why a cell that has just completed cytokinesis might enter the G0 phase instead of the G1 phase.
    12·1 answer
  • When chromatids fail to separate properly during which phase is this problem most likely to occur
    12·1 answer
  • How do you know when a chemical reaction has taken place?
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which statement describes gravity? There is no defined unit of measurement for gravity Gravity is the force that pulls objects t
    10·2 answers
  • Select the correct answer
    15·2 answers
  • Why does the the right testicle hang lower than the left?? PLease help i will be thank (Sorry english second language if your wo
    11·1 answer
  • Match each type of mutation with the correct chemical sequence for ACGT 1. A-C-G-G-T 2. C-GT 3. A-GC-T duplication, deletion, re
    8·1 answer
  • Name the gland cells of the epithelium in the small intestine.
    15·1 answer
  • What is the process in which certain cognitive functions are located more in one hemisphere of the brain than in the other?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!