1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrej [43]
3 years ago
11

Why are archaea in a different domain from bacteria?

Biology
1 answer:
IgorC [24]3 years ago
6 0

Answer:

this is correct answer

Explanation:

D. They have no similar characteristics.

I hope it's helpful for you....

You might be interested in
¿Cuál es la novena parte 177?
marshall27 [118]

Answer:

umm well I dont know to. be honest

4 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Suppose that enzyme X catalyzes a reaction that involves the breakdown of a molecule. The product of this reaction is an amino a
vesna_86 [32]

Answer:

Protein

Explanation:

  • An enzyme is a biocatalyst that plays an important role in increasing the speed of the chemical reactions that occurs in the body.
  • If the enzyme is catalyzing a reaction where the product is broken down into amino acids, then this reaction is a type of decomposition reaction.
  • In a decomposition reaction, a substrate is broken down into the products that constituted it.
  • Since amino acids join to form a protein thus, the molecule that is being broken down in the reaction must be a protein.
4 0
3 years ago
Read 2 more answers
Which of the following explains Mendel's principle of segregation?
Elanso [62]

Answer:

C. Genes that are close to each other on a chromosome are often inherited together.

5 0
2 years ago
n the 1950’s, Anfinsen carried out denaturation and renaturation experiments of the protein RNAse (ribonuclease) in vitro. After
beks73 [17]

Answer and Explanation:

The regular synthetic denaturant of proteins is urea. The high grouping of urea causes unfolding of protein and accordingly brings about loss of capacity of protein. The urea communicates with the protein and counteracts collapsing of protein.

During oxidation, the disufide bonds that are required for legitimate working and adjustment of protein are shaped, while in nearness of urea, the disulfide bonds are not situated effectively. The protein oxidation brings about covalent adjustment of protein that outcomes in change of physical and substance properties of protein.

The difference in physical and chemical properties of protein after oxidation and in nearness of urea can't be altered even after expulsion of urea. Along these lines, protein doesn't crease appropriately.

5 0
3 years ago
Other questions:
  • What is the function of the mitochondria?is it used for aerobic or anaerobic respiration?
    11·1 answer
  • Trying to find the rightful heir! Y’all do your best can I put ears and eyes in the same punnet or do I need to make a second??
    9·1 answer
  • Extended family relationships are very important to african americans, who:
    7·1 answer
  • 1. The______ provides support and rigidity to cells allowing plants to stand upright.
    11·1 answer
  • Based on the phylogenetic tree below, which groups of plants evolved most recently?
    13·1 answer
  • 1 point<br> Box A<br> D<br> 1<br> F<br> Choose<br> This is a required question
    7·1 answer
  • List the reactions of glycolysis that: _________
    13·1 answer
  • Unlike DNA, RNA contains...
    12·1 answer
  • Where are fossils mostly found
    14·1 answer
  • Which of the following is one of the products of cellular respiration?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!