1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vanyuwa [196]
3 years ago
12

Based on your understanding of nucleic acids, what type of bonds form between the CRISPR/guide RNA molecule and the target DNA

Biology
1 answer:
Tanya [424]3 years ago
6 0

Answer:

The single guide RNA forms hydrogen bonds with DNA, while Cas9 hydrolyzes phosphodiester bonds

Explanation:

The base pairing between nucleic acid strands (either DNA or RNA) is through hydrogen bonds between nucleotide bases. In DNA, Adenine always forms two hydrogen bonds with Thymine, while Guanine always forms three hydrogen bonds only with Cytosine. Moreover, adjacent nucleotides in the same strand are covalently linked by phosphodiester bonds (i.e., covalent bonds between the 5' phosphate group of one nucleotide and the 3'-OH group of another). The CRISPR/Cas9 genome editing systems make use of single-guide RNAs (sgRNAs) that interact with DNA through hydrogen bonds. These sgRNAs have perfect complementarity to the target DNAs in order to bind them. On the other hand, Cas9 is an enzyme that hydrolyzes phosphodiester bonds in both DNA strands very precisely and accurately by using a sgRNA complementary to a specific DNA sequence.

You might be interested in
Goodmorning, can someone please help me figure this out? Thanks
siniylev [52]

Answer:

Vacuole.

Hope this helps!

Explanation:

3 0
3 years ago
Read 2 more answers
Think about how you would determine the number of atoms in each element of a chemical formula that contains subscripts. Explain
kotegsom [21]

Answer:..

Explanation:

5 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
A group of puppies have different fur colors. This is an example of
AnnZ [28]

genetic diversity

Explanation:

4 0
3 years ago
Which of the following is true regarding respiration in birds?
Ierofanga [76]

idk....................,. where are the options

4 0
2 years ago
Other questions:
  • Which of the following is the simplest unit of a nucleic acid
    10·2 answers
  • True or false please help
    15·2 answers
  • If the frequency of the recessive allele for a gene is 0.3, calculate the expected frequency of heterozygotes in the next genera
    15·1 answer
  • Which of these is a shortcoming of the Clean Water Act? A.) excludes drain pipes B.) excludes lakes, rivers and streams c.) excl
    12·1 answer
  • Nucleotide differences for a DNA sequence on chromosome 1 are shown for five species. According to the data, which hypothesis is
    11·1 answer
  • The three methods of determining population size are observation, mark and recapture, and sampling
    11·1 answer
  • During the first step of cellular respiration, glucose is converted into
    7·2 answers
  • Most protists are______.<br> A)Unicellular<br> B)Heterotrophs<br> C)Autotrophs<br> D)Multicellular
    12·1 answer
  • What is the term for the circular movement of material inside earth’s mantle
    7·2 answers
  • The dry bulb is 14C and the wet bulb is 8C. What is the wet bulb depression?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!