1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lidiya [134]
3 years ago
7

A true-breeding plant that produces yellow seeds is crossed with a true-breeding plant that produces green seeds. The F1 plants

have yellow seeds. What is the expected phenotypic ratio of seed color of the offspring of an F1 × F1 cross?
Biology
1 answer:
nadya68 [22]3 years ago
8 0

Answer:

The phenotypic ratio will be 3:1

Explanation:

As per this question there are two phenotypes for seed color, yellow and green. Both the parents are true breeding that means they are homozygous for this trait. Also, all the F1 plants have yellow seed color which clearly indicates that yellow seed color is a dominant trait while green is recessive trait.

The cross of true breeding plants as mentioned above is depicted as under:

Parents                             YY    x   yy

                                          /   \       /   \

F1 generation                Yy   Yy  Yy   Yy

So, as per the law of dominance because of the presence of Y allele, all these progeny will be yellow in color.

Next, when these F1 plants will be crossed, the result will be as under:

F1 generation                    Yy   x    Yy

                                         /   \         /   \

F2 generation               YY   Yy   Yy   yy

The genotypic ratio of F2 generation is 1:2:1

The phenotypic ratio of F2 generation is 3:1

It simply means that in F2 generation, 3 progeny which have allelic combination YY & Yy will be yellow colored while 1 progeny which has allelic combination yy will have green color.

You might be interested in
As part of an experiment to measure decomposition rates of different materials, students put food scraps from the cafeteria in c
Yakvenalex [24]
The greatest error in the experimental design is that the temperature of both bins were taken at different times from each other. The students should have measured them at the same time to lessen the randomness of the variables. A way to "fix" this is by changing taking into account the extra time between bin A was and bin B was measured for bin B's calculations.
8 0
3 years ago
Which of these shows the levels of organization in the correct order from smallest to largest?
Gre4nikov [31]

Answer:

<em><u>B</u></em>

Explanation:

cell is the first organization level

tissue is the second level

organ is the third level

organ systam is the fourth level

organsim is the last organization level

5 0
1 year ago
The chemical reaction below represents a metabolic process. Which metabolic process listed below uses the products of this react
san4es73 [151]
What is the chemical reaction in the problem?
7 0
2 years ago
Although Natasha is a brilliant pianist snd highly acclaimed ballet dancer, her high school intelligence test scores were only a
schepotkina [342]

Answer:

It suggests she have bodily-kinesthetic intelligence according to Howard Gardener's theory of multiple intelligences.

Explanation:

Howard Gardener's theory of multiple intelligences suggests that there are eight different types of intelligence instead of a single generalized one. Bodily-kinesthetic intelligence is one of them that is the ability to skilfullly use the body or its parts.

Natasha's experience tells that she may be high on this specific kind of intelligence as athletes like her and dancers like her are high on bodily-kinesthetic intelligence.

6 0
3 years ago
What would happen if introns were not removed during RNA processing?
Savatey [412]

Answer:

The protein would be incorrect and the protein might not function.

Explanation:

We know that introns carry information but introns not only carry information to build a protein. They have to be removed for the mRNA to encode a protein with the right protein sequence.

If the spliceosome fails to remove an intron, an mRNA with extra "junk" will be created in it. As a result, a wrong protein will be created during translation.

If a wrong protein sequence is created, it will hamper the whole translation process. The protein won't function properly.

7 0
2 years ago
Read 2 more answers
Other questions:
  • ______________ chemically alter the make-up of nutrients, changing them into a form that can be readily used by cells.
    10·2 answers
  • Which of the following is an example of a disease that is properly matched with one of its environmental risk factors?
    6·1 answer
  • BRAINLIESTT ASAPPPP!!
    14·2 answers
  • When converting from kilometers to meters, the decimal is moved _______.
    9·2 answers
  • Describe genetic diversity
    13·1 answer
  • Explain how manure and human hair can cause ill health to human beings
    8·1 answer
  • He ________ is located deep within the brain, and it includes structures such as the substantia nigra and ventral tegmental area
    8·1 answer
  • What snake is the most poisonous one?
    5·1 answer
  • Multigene families are Multigene families are groups of enhancers that control transcription. sets of genes that are coordinatel
    5·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!