1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
poizon [28]
2 years ago
14

In which of Earth's atmospheric layers does weather occur?

Biology
2 answers:
Over [174]2 years ago
8 0
The awnser is A.....
Allisa [31]2 years ago
4 0
The answer is a. the troposphere
You might be interested in
Drag and drop a term to match these examples with the correct level of organization. Organ Organ system Tissue
sineoko [7]

Answer:

This question is incomplete as the term to match with the level of organisation is not included, the terms are;

circulatory system

cardiac muscle

heart

human body

The ANSWER is:

Organ = heart

Organ system = circulatory system

Tissue: cardiac muscle

Explanation:

The level of organization of multicellular organisms is made up of cell, tissue, organ, organ system and eventually organism.

- The tissue is composed of several cell, which are basic units of any living organism. Cells that perform similar function come together to form the tissue. Example is the CARDIAC MUSCLE in this question, which is a muscular tissue made up of cells called myocardiocytes.

- Organs are structures formed as a result of collection of tissues with similar function. For example, the HEART is a circulatory organ made up of cardiac tissues, connective tissues etc.

- Organ systems is made up of organs that perform the same function in a living organism. In the case of the CIRCULATORY SYSTEM, it is made up of organs such as heart, blood vessels, lungs etc.

7 0
3 years ago
10.
Viktor [21]

Answer:

The overall chemical reaction of cellular respiration converts one six-carbon molecule of glucose and six molecules of oxygen into six molecules of carbon dioxide and six molecules of water. ... So the carbons in the glucose become oxidized, and the oxygens become reduced.

7 0
3 years ago
Read 2 more answers
The synthesis of giant molecules from components of repeating units is _____. polymerization hydrolysis
Bezzdna [24]
Polymerization would be the answer you're looking for.
5 0
3 years ago
Read 2 more answers
A forest habitat is home to a certain population of squirrels. Some of the squirrels
Sergio [31]
Just use quiz lit and it’ll give you all the answers have a great day
5 0
3 years ago
Describe how old world monkeys might have arrived in the new world
Katen [24]
The could have snuck away on a ship, as they are very sneaky
6 0
3 years ago
Other questions:
  • Why does the reporter have a tube up his nose?
    8·1 answer
  • Define and distinguish between health and cure​
    14·1 answer
  • New biosensors, applied like a temporary tattoo to the skin, can alert serious athletes that they are about to "hit the wall" an
    5·1 answer
  • If flying squirrels were brought to Australia, what would their relationship be with sugar gliders
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Select all the correct answers.
    13·1 answer
  • The application of scientific knowledge for some specific purpose is known as
    15·1 answer
  • What is blood transfusion why should we donate the blood​
    10·1 answer
  • Please hurry, this a quiz, and it, not 4 cells, is wrong.
    11·1 answer
  • The diploid number of chromosomes in humans (homo sapiens) is 46 and the diploid number of chromosomes in rice (oryza sativa) is
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!